ID: 1133893066

View in Genome Browser
Species Human (GRCh38)
Location 16:9900041-9900063
Sequence TGAGATACACAACGTGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133893063_1133893066 22 Left 1133893063 16:9899996-9900018 CCATGTCACTGGGTAATTATAGG 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1133893066 16:9900041-9900063 TGAGATACACAACGTGATAAAGG 0: 1
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133893066 Original CRISPR TGAGATACACAACGTGATAA AGG Intronic
905684559 1:39899531-39899553 TGAGATCCAGAACGTTACAAAGG - Intronic
916459797 1:165011594-165011616 TGAGTTACACAATGAGACAAGGG + Intergenic
917359169 1:174158213-174158235 TGAGATACAGAAGTTAATAAGGG + Intergenic
1062930926 10:1351959-1351981 TGAGATACAGAACAGAATAATGG - Intronic
1064094045 10:12409347-12409369 TAAGTTACACATTGTGATAACGG + Intronic
1067936166 10:50614023-50614045 TGAGATACATAACCTGACAGTGG - Intronic
1068506955 10:57913058-57913080 TGATATACACAATCAGATAAAGG - Intergenic
1069748341 10:70730203-70730225 TGAGGAACACAACGTGGTCATGG - Exonic
1072070761 10:91914422-91914444 TAAGAGACACAATGGGATAAGGG - Intergenic
1087629872 11:100637411-100637433 TGAGATAAACAATGAGCTAAGGG + Intergenic
1094089322 12:26630422-26630444 AGAGATACACAAAGTGATGGGGG + Intronic
1096350521 12:50895640-50895662 TGAAATACACAAAGCGAAAATGG + Intergenic
1098466999 12:70798755-70798777 TGAGATAGAGAATGTGATGAGGG - Intronic
1099206408 12:79733236-79733258 TGAGAGACACACCATGATCATGG + Intergenic
1101379277 12:104200181-104200203 TGACATACACAAAGTGCTGAAGG - Intergenic
1107191767 13:37596592-37596614 AGAGGTCCACAAGGTGATAACGG - Intronic
1109639817 13:65176029-65176051 TGAAATACACAATATTATAAAGG - Intergenic
1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG + Intergenic
1112789134 13:102984381-102984403 TGACATAGACAATTTGATAAAGG - Intergenic
1114130929 14:19791183-19791205 AGAGATACACAAAATCATAAAGG - Intronic
1114660920 14:24344135-24344157 TGACAGACATAACGTGATAGAGG + Intergenic
1115581324 14:34761636-34761658 TAAGATACACAAAGTTATTAGGG - Intronic
1119053741 14:71396676-71396698 ATAGATACACAACGTAATTAGGG - Intronic
1120041806 14:79762105-79762127 TGAGATACAGAACTCCATAAAGG - Intronic
1123573984 15:21646805-21646827 AGAGATACACAAAATCATAAAGG - Intergenic
1123610600 15:22089390-22089412 AGAGATACACAAAATCATAAAGG - Intergenic
1202982848 15_KI270727v1_random:381145-381167 AGAGATACACAAAATCATAAAGG - Intergenic
1133893066 16:9900041-9900063 TGAGATACACAACGTGATAAAGG + Intronic
1137999633 16:53262182-53262204 GAAGATACACAATGTGTTAAGGG - Intronic
1138355398 16:56373856-56373878 TGAGATACACACTTTGAAAATGG + Intronic
1139943556 16:70623276-70623298 TGAGATCCAGAACATAATAATGG + Intronic
1141572835 16:84944574-84944596 TGACATACAAAATGTGATTAGGG - Intergenic
1151773851 17:76184421-76184443 TGAGATACATAACGTGTCCAAGG + Intronic
1153263919 18:3249330-3249352 AGAGATACACAACATGATTAAGG - Intronic
1155468258 18:26163309-26163331 TGATATACACAAGGTGGTCAGGG + Intronic
1155715631 18:28940115-28940137 TGAGATCCAGAAAGAGATAAAGG + Intergenic
1155903040 18:31414679-31414701 AGAGAAACACAACTTGGTAATGG - Exonic
1164080968 19:21861029-21861051 TGAGATACAGAACAGAATAATGG - Intergenic
1164258930 19:23552476-23552498 TGAGATACAGAACAGAATAATGG - Intronic
925153466 2:1633344-1633366 TCAGATACACAATGGGATGAAGG + Exonic
925358327 2:3259211-3259233 TGAAATACACAAGATGACAAAGG + Intronic
925562927 2:5217696-5217718 TGAGATACACAACTTTATGACGG - Intergenic
933055761 2:77662237-77662259 TGAAATACACCATGTGAAAACGG - Intergenic
936794122 2:116186748-116186770 TGAGATACAGAACAGAATAATGG + Intergenic
939752980 2:146071805-146071827 TGAGATAGAAAATGTGTTAATGG + Intergenic
940530353 2:154870543-154870565 TGAGATCCACAACAGAATAATGG - Intergenic
942572561 2:177328703-177328725 TGAGATTCCCAACGTCATAGAGG + Intronic
943254481 2:185576384-185576406 TGAGAAACACTACGTGACAATGG + Intergenic
947660793 2:231865510-231865532 TGAGAAACAGAATGTGAAAAGGG - Intergenic
948415764 2:237802199-237802221 TGAGAAACACAAGGTGGTATGGG - Intronic
1176992682 21:15517802-15517824 AAAGATACACAATTTGATAAAGG - Intergenic
1177075179 21:16563282-16563304 GGAGATACACAGATTGATAAAGG - Intergenic
949161921 3:893150-893172 TGAGATCCAGAACGGAATAATGG + Intergenic
950830960 3:15875839-15875861 GGAAATACAGAACATGATAAGGG - Intergenic
950954559 3:17037632-17037654 TGAGATTCAAAACAAGATAAAGG + Intronic
956173841 3:66454840-66454862 TAAGCTACAAAATGTGATAAAGG + Intronic
957390630 3:79562466-79562488 TGATATATACAAAGAGATAATGG - Intronic
961100706 3:124196181-124196203 TAAGATAGACAACCTAATAAGGG - Intronic
961933285 3:130555854-130555876 TGAGAAACTCAACTTGATAGTGG + Intergenic
964131046 3:153287229-153287251 TGAGAAACACCACGTGATGTGGG + Intergenic
965265769 3:166540944-166540966 TGAGATGCTCAATCTGATAAAGG + Intergenic
967588393 3:191242020-191242042 TGTGATAAACAACATGATAATGG - Intronic
969553243 4:7886738-7886760 TAATATACAGAACGTGATAATGG + Intronic
971387667 4:26156042-26156064 TGACATAAACAACTTGTTAATGG + Intergenic
971939973 4:33201423-33201445 TGAGATATAGAAAGTGGTAAAGG + Intergenic
976696708 4:87925092-87925114 TGAGATATAGAACAGGATAATGG - Intergenic
977198264 4:94087114-94087136 TGAGATATAGAACAGGATAATGG + Intergenic
979058443 4:116024394-116024416 TGACATACTCAACGTGAAAGAGG + Intergenic
983251436 4:165350972-165350994 TGAAATCAAAAACGTGATAAAGG - Intergenic
983452500 4:167926118-167926140 TGAGATACAGAACAGAATAATGG - Intergenic
989355613 5:40540478-40540500 GGACATACACAATGTGGTAATGG + Intergenic
993620057 5:90157397-90157419 TGAGAAACACAAAGTGAAGATGG + Intergenic
993989218 5:94636083-94636105 TGATATACTCAAAGTGATAAAGG - Intronic
994879925 5:105477075-105477097 TGATATACTCAAAGTGCTAAAGG + Intergenic
999851064 5:155539960-155539982 TGAGATACACAATGTACTATTGG + Intergenic
1000341597 5:160281004-160281026 TGAGATACACAAGGCCATAAAGG + Intronic
1010616812 6:78022890-78022912 TGACATACAGAAAGTGCTAATGG + Intergenic
1013300445 6:108800263-108800285 TGAGATAGATTACATGATAAAGG + Intergenic
1013639365 6:112058199-112058221 TTACATGCACAACGTGAGAATGG - Intronic
1014340600 6:120201682-120201704 GGAGTTACTCAACATGATAAAGG + Intergenic
1020897763 7:13963138-13963160 TGAGATACAGGATGTGAAAATGG + Intronic
1021393788 7:20123821-20123843 TGAGATCCAGAACAGGATAATGG - Intergenic
1021430015 7:20548667-20548689 TGAGATCCAGAACAGGATAATGG - Intergenic
1023685134 7:42725814-42725836 TGAGATAGAAAAAATGATAAAGG - Intergenic
1023737129 7:43245159-43245181 TGGGATACTCAAGGAGATAAAGG - Intronic
1024087873 7:45911643-45911665 TCACATACAACACGTGATAAGGG + Intergenic
1027347630 7:77277434-77277456 TGAGATACAGAAATTGATAAAGG + Intronic
1028310317 7:89324235-89324257 TAAAATACACAAAGTGAAAATGG - Intronic
1028851900 7:95547159-95547181 TGAAATACACAACTTTAAAATGG + Intergenic
1031116773 7:117677497-117677519 TGAGCTACAGAAAGGGATAAGGG + Intronic
1031774238 7:125886672-125886694 TGATATATACAAAGTGCTAAGGG + Intergenic
1035961496 8:4143691-4143713 TAAGATACACAAAGTAACAAAGG + Intronic
1036129302 8:6093671-6093693 TGAGATAGACAGCGTGACCAAGG + Intergenic
1041163614 8:55070125-55070147 TGACATACACAATGTGATATAGG + Intergenic
1042031489 8:64480685-64480707 TAAGAGACACAAAGTGAAAAAGG + Intergenic
1042449964 8:68932753-68932775 TGAGATACAGAAAGTGAGTAGGG + Intergenic
1042521642 8:69718538-69718560 TTAAAAACACAATGTGATAAGGG - Intronic
1046003102 8:108444734-108444756 TGAGATTCACAACGTGCTAGAGG - Intronic
1048698040 8:137050494-137050516 AGAGAAACACAAGGTGAAAAGGG + Intergenic
1050257938 9:3813651-3813673 TGAGATCCAGAACAGGATAATGG + Intergenic
1050410402 9:5358375-5358397 AGAAATACACAAGGTGACAAAGG + Intronic
1056969875 9:91193104-91193126 CGTGAAACACAACGTGAGAATGG + Intergenic
1061749310 9:132765324-132765346 TGAGATGCACCACATGATTATGG - Intronic
1061904898 9:133691661-133691683 TGATTTACACAATGTGATCAAGG - Intronic
1186408162 X:9321894-9321916 TGACGTACGCAAAGTGATAAAGG + Intergenic
1192445507 X:71208120-71208142 TGAGCTACACATATTGATAAAGG - Intergenic
1192731351 X:73805388-73805410 TGAGATCCAGAACATAATAATGG + Intergenic
1194171857 X:90595956-90595978 TGTGATACAGAAAGTGTTAAGGG - Intergenic
1195555262 X:106214212-106214234 TTAGATTCACCAAGTGATAAGGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1200518088 Y:4173703-4173725 TGTGATACAGAAAGTGTTAAGGG - Intergenic
1200775690 Y:7168190-7168212 TGAGATCCTTAAGGTGATAAGGG - Intergenic