ID: 1133895648

View in Genome Browser
Species Human (GRCh38)
Location 16:9926123-9926145
Sequence GAACTCTCCTTGGGTAATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133895641_1133895648 22 Left 1133895641 16:9926078-9926100 CCAACCTTAAAATAACATCTACA 0: 1
1: 0
2: 0
3: 23
4: 320
Right 1133895648 16:9926123-9926145 GAACTCTCCTTGGGTAATTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1133895642_1133895648 18 Left 1133895642 16:9926082-9926104 CCTTAAAATAACATCTACAAATT 0: 1
1: 0
2: 7
3: 55
4: 611
Right 1133895648 16:9926123-9926145 GAACTCTCCTTGGGTAATTCAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133895648 Original CRISPR GAACTCTCCTTGGGTAATTC AGG Intronic
906253847 1:44332419-44332441 GAACTTTCCTTGGGGAACACTGG - Intronic
909455694 1:75846079-75846101 GAACTCTGCTTCCTTAATTCTGG - Intronic
909507775 1:76413569-76413591 CAACTCTCCTTTGGTAATGTGGG + Intronic
915160401 1:153915485-153915507 TAACTCTCTTTGGGCAAGTCAGG + Intronic
917634986 1:176926860-176926882 GACCTGTCCTTGTGTATTTCAGG - Intronic
918563414 1:185896999-185897021 CAACTTTCCTTTTGTAATTCTGG + Intronic
922406861 1:225323271-225323293 GAAGTCTCCTTGTGCACTTCAGG - Intronic
1063952825 10:11240198-11240220 GAACACTGCTTTGGAAATTCGGG - Intronic
1067077944 10:43198712-43198734 GAACTCGCCTTAGGTGATGCCGG + Intronic
1067098079 10:43315384-43315406 GAACTCTCCTTGGCTTTCTCTGG - Intergenic
1071144185 10:82548301-82548323 GAACTTTCCTTGACTAATTAAGG + Intronic
1074183809 10:111084610-111084632 GAACTCTTGTTGGGTAATACTGG + Intergenic
1080178428 11:29394518-29394540 GAACACTCCTTGAATAATGCAGG + Intergenic
1085936189 11:81147582-81147604 AAACTCTCCTTCAGTAATCCTGG - Intergenic
1086310594 11:85532013-85532035 GATCTCTCCTTGGATAATAATGG - Intronic
1090709204 11:129371148-129371170 TAACTCTCCTTGTGTAATTTTGG - Intergenic
1093876213 12:24352537-24352559 AAACTCTACTTTGCTAATTCTGG + Intergenic
1104029873 12:125057328-125057350 GGACTATCCTCGGGTACTTCTGG + Intergenic
1108852617 13:54752318-54752340 TAACTCTCCTTGACTAAGTCAGG + Intergenic
1113313879 13:109158274-109158296 GAAATGTCCTTGAATAATTCTGG - Intronic
1115657714 14:35459641-35459663 GAGCTCTCCTTGAGTTATTTTGG + Intergenic
1115681186 14:35740130-35740152 TAACTCTGCTTGGGGAAATCAGG - Intronic
1116175789 14:41468957-41468979 GGACTCTCCCTGGGTAACTAAGG - Intergenic
1123206206 14:106715614-106715636 GAACTCTCCATGGGTCCTGCTGG - Intergenic
1123211289 14:106763024-106763046 GAACTCTCCATGGGTCCTGCTGG - Intergenic
1127939518 15:63680594-63680616 GAAATCTCCTTGAGTAAAGCTGG + Exonic
1129947263 15:79549881-79549903 GATCTGTCTCTGGGTAATTCAGG + Intergenic
1131412135 15:92218312-92218334 ACATTCACCTTGGGTAATTCAGG + Intergenic
1133688502 16:8189920-8189942 GAAATCTCCTTGGTAGATTCAGG + Intergenic
1133895648 16:9926123-9926145 GAACTCTCCTTGGGTAATTCAGG + Intronic
1134750716 16:16622878-16622900 GAAATCTCCTTGTGTCAGTCTGG + Intergenic
1134994739 16:18730712-18730734 GAAATCTCCTTGTGTCAGTCTGG - Intergenic
1135379247 16:21980396-21980418 GCATTCTTCTTGGGGAATTCAGG + Intronic
1139218395 16:65152486-65152508 GAGCTCTGCCTGGGGAATTCAGG + Intergenic
1140298472 16:73731982-73732004 GAACCCTACTTGGGGATTTCAGG + Intergenic
1141611796 16:85185816-85185838 GAACCCTCCCTGGGGCATTCTGG + Intergenic
1142555509 17:773945-773967 GAAATCCCCTTGGGCATTTCTGG - Intronic
1145166212 17:20614884-20614906 CAGATCTCCTTGGGTAAATCTGG - Intergenic
1145462404 17:23413279-23413301 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1145473605 17:23575803-23575825 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1145476202 17:23613471-23613493 GAACCTTCCTTTGATAATTCAGG + Intergenic
1145536157 17:24485796-24485818 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1145538752 17:24523614-24523636 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1145555154 17:24762272-24762294 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1145629412 17:25843009-25843031 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1145639208 17:25984580-25984602 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1152372042 17:79894695-79894717 GAATGCTCCTTGGGGAACTCTGG + Intergenic
1156513414 18:37660402-37660424 GACCTCTTCTTGAGTAACTCTGG + Intergenic
1157142322 18:45121953-45121975 GAACTCTACTTGGGCAAATGTGG + Intergenic
1157495361 18:48153414-48153436 TGCCTCTCCCTGGGTAATTCAGG + Intronic
1158119243 18:54030059-54030081 GAATTGTCCTTGGGCAATTGAGG - Intergenic
1162574214 19:11489498-11489520 GATCTCTACTTGGGAAAATCAGG - Intronic
931254751 2:60560619-60560641 GTACAGTCCTTGGGTAACTCAGG - Intergenic
931664876 2:64603154-64603176 GAGGTCTCTTTGGGTGATTCTGG - Intergenic
934578996 2:95423275-95423297 GTACACTCCTTGGGTAATGGGGG + Intergenic
934600451 2:95653428-95653450 GTACACTCCTTGGGTAATGGGGG - Intergenic
1169341186 20:4797674-4797696 GTTCTCTCGTTGGGCAATTCGGG - Intronic
1170142634 20:13140322-13140344 CAGCTCTCCTTGGGTACTTTTGG + Intronic
1171874010 20:30554936-30554958 GAATTCTCCAAAGGTAATTCTGG + Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174701613 20:52614759-52614781 GACCTCTCCTTGTGTGATGCTGG - Intergenic
1174766295 20:53256849-53256871 GAGCTTGCCTTGGGTAATTCAGG - Intronic
1178133535 21:29600358-29600380 GAACTCACATTGGGTATCTCTGG + Intronic
1182170455 22:28223596-28223618 GAAATCTCTTTGGGAAGTTCAGG - Intronic
950938307 3:16866133-16866155 GGGCTCTCCTTGGGGAGTTCAGG - Intronic
956721333 3:72120638-72120660 GAATTCTCCTTGGGACATTTTGG - Intergenic
964848945 3:161073344-161073366 GAACACCCTTTGGGAAATTCTGG + Exonic
970869987 4:20804993-20805015 GAACCCTTCTTGGGAAATTTTGG - Intronic
972344457 4:38181333-38181355 GAGCTCTCCCTGGGGAATCCCGG - Intergenic
976214601 4:82704458-82704480 GTACTTTCCTTGGGTACTTTTGG - Intronic
977750571 4:100605224-100605246 AAAATCTCATTGGGTAATTAAGG - Intronic
978500657 4:109406491-109406513 TTACCCTCCTTGTGTAATTCAGG + Intergenic
980793162 4:137646273-137646295 GACATCTCCTTGGGTAAAACTGG - Intergenic
982468892 4:155762202-155762224 AAATGCTCCTTGGGTGATTCTGG + Intronic
984704905 4:182840481-182840503 GAAAGCTCCCTGGGTGATTCTGG - Intergenic
985481937 5:118269-118291 GAAATCTCCTACGGTAATTCTGG - Intergenic
985505177 5:275254-275276 GAAATCTCCCAGGGCAATTCAGG - Intronic
988486342 5:31671059-31671081 GAACTGTCCTTAGGTGATCCAGG + Intronic
989733665 5:44677173-44677195 GAAAACTACTTGGATAATTCAGG + Intergenic
991000248 5:61775579-61775601 GAAGTCTGCTTAGGTATTTCAGG - Intergenic
991285413 5:64969871-64969893 TAATTCTCCTTGCTTAATTCCGG - Intronic
995556057 5:113329986-113330008 CAACTGTCCTTATGTAATTCAGG - Intronic
997011902 5:129888293-129888315 TAACTCTGCTTGGGAAATTCTGG - Intergenic
1005249245 6:23925982-23926004 GCACTCTCCTTGGCAAAGTCTGG + Intergenic
1011672218 6:89694291-89694313 CACCTCTCCTTGGGTCATTCAGG - Intronic
1013487792 6:110614630-110614652 GAACGCTGCTTTGGTAATTCAGG + Exonic
1013571394 6:111429929-111429951 GAACTCTCCGTGGGCAGCTCGGG + Intronic
1014681655 6:124438373-124438395 GAAGTCACTCTGGGTAATTCAGG + Intronic
1015252587 6:131142612-131142634 AAACTCTCCTAGGGCAATGCTGG + Intronic
1016576443 6:145574014-145574036 GAAGTCTCCTTGGGGAAGTACGG + Intronic
1017771645 6:157649351-157649373 TAGCTTTCCTTGGGTCATTCTGG + Intronic
1017870021 6:158479204-158479226 GAACCACCCTTGGGTAATTTGGG + Intronic
1022328716 7:29357379-29357401 GAACTCTCTTTTGGTCATCCTGG + Intronic
1022561514 7:31354471-31354493 AAACTCTTCTTGGGGTATTCTGG - Intergenic
1028402823 7:90442732-90442754 GAACTCTGCTTCTGTACTTCTGG + Intronic
1028529382 7:91821661-91821683 CAACTCTCCTTGGTTAAACCAGG - Intronic
1029794338 7:102877989-102878011 GAACACCCCTTGGGAAATGCTGG + Intronic
1032651833 7:133887228-133887250 GAAATCTCCTTGGGTGGTTTGGG - Intronic
1038932015 8:32203871-32203893 GAACTATCCATGGGTATTACTGG - Intronic
1040784329 8:51147974-51147996 GAACTCTTCTTGGGTAAAAAGGG - Intergenic
1041539673 8:58969121-58969143 AAACTCTCCTGGGGTAAGACAGG + Intronic
1042862795 8:73330742-73330764 GGACTCTCCTTGTTTAATTTTGG - Intergenic
1046859227 8:119071501-119071523 GAACTATCCTTGGGAAGATCTGG - Intronic
1047578650 8:126187488-126187510 GACCTTTGCTTGGATAATTCCGG - Intergenic
1048965995 8:139614916-139614938 GGGCTCACCTTGGGTGATTCTGG + Intronic
1051722888 9:20056955-20056977 TAACTCTTCTTGGGTAATACTGG + Intergenic
1052558918 9:30058301-30058323 TAACTCTCGTTCAGTAATTCTGG - Intergenic
1052655813 9:31358513-31358535 CAACTCTCCTTGGAGAAGTCTGG + Intergenic
1055992089 9:82117488-82117510 GAGCTCTCCTTTGGTAAATAGGG - Intergenic
1056016592 9:82395117-82395139 GAACTCTCCTGGGGAAAGTGTGG + Intergenic
1059683386 9:116608132-116608154 GAACTCTGTCTGGGCAATTCAGG - Intronic
1189586814 X:42470234-42470256 GTTCTCTCCTGGGGTGATTCTGG + Intergenic
1190846187 X:54193086-54193108 GAACTCTCCTTTCTTAATTGGGG - Exonic
1191279727 X:58648152-58648174 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1191350108 X:59588554-59588576 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1191390636 X:60130087-60130109 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1191469503 X:61186413-61186435 GAACCTTCCTTTGGTAGTTCAGG + Intergenic
1191499025 X:61581572-61581594 GAACTTTCCTTTGATAGTTCAGG + Intergenic
1192344692 X:70291372-70291394 TAACTCTGCTTGGGGAATTTGGG + Intronic
1192903301 X:75522879-75522901 GAACTCTGCCTGGGTAAGTGGGG - Exonic
1195052556 X:101110735-101110757 GAAATCTCATTGGGGAATTAAGG + Intronic
1197832381 X:130657430-130657452 GAACTCTCCTTGAGTTCTTTAGG - Intronic
1199826183 X:151502879-151502901 GAAATCTGCTTGGCTAATTTTGG + Intergenic