ID: 1133898001

View in Genome Browser
Species Human (GRCh38)
Location 16:9947718-9947740
Sequence CTCTTTCTCTTACTGGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133897999_1133898001 1 Left 1133897999 16:9947694-9947716 CCAAATAGAGGGTTCAAATTTCA 0: 1
1: 0
2: 0
3: 18
4: 183
Right 1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG 0: 1
1: 0
2: 3
3: 35
4: 345
1133897995_1133898001 29 Left 1133897995 16:9947666-9947688 CCTGTTATCAAAGGCACAGACAC 0: 1
1: 1
2: 1
3: 12
4: 197
Right 1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG 0: 1
1: 0
2: 3
3: 35
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133898001 Original CRISPR CTCTTTCTCTTACTGGTGTC TGG Intronic
900615456 1:3563682-3563704 CTCTCTTTCTTAGGGGTGTCAGG - Intronic
900644982 1:3704906-3704928 CTCCTGCTCCTCCTGGTGTCTGG - Intronic
901440509 1:9275239-9275261 GTCCTTCTCTTACTGGGGCCAGG + Intergenic
902840137 1:19069154-19069176 CTCCTTATCTTACGGGTGTCAGG - Intergenic
903054910 1:20629195-20629217 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
903857860 1:26347245-26347267 TTGTTTCTCTTACTGGACTCTGG - Intronic
904098811 1:28004475-28004497 CTCTTTCTGTTATTGATTTCTGG - Intronic
904260726 1:29286117-29286139 CTCTCTCTCTTGCTGGTGTCTGG - Intronic
904781022 1:32948165-32948187 CTCATTCTCTTACTGATTTAGGG - Intronic
905993497 1:42360389-42360411 CTCTCTCTCTTTTTGGAGTCAGG - Intergenic
906016464 1:42585840-42585862 CTCTTTTTCTTACTGATTTATGG + Intronic
906438217 1:45815624-45815646 CACTTTCTCTTACTGGTTAAAGG - Intronic
906503722 1:46361548-46361570 TTCTGTCTCTTTCTGGTTTCAGG + Exonic
906727562 1:48055048-48055070 ATGTTTCTCTTATTGGTGACAGG + Intergenic
907469130 1:54661080-54661102 CTCTTTTTCTTATTGGTTTGTGG + Intronic
907796252 1:57720798-57720820 CTCCTTGTCTTACTGGTGTCTGG + Intronic
908490012 1:64634116-64634138 CTTTTTGTCTCACTGGTGGCTGG - Exonic
909438782 1:75674073-75674095 CTCTCTCTGTGACTGGTGCCTGG - Intergenic
909505132 1:76379627-76379649 CTCTTTCTCTTTGTGGTGTGTGG + Intronic
910828598 1:91435886-91435908 CTTTTTCTCTTACTGGAATTGGG + Intergenic
911335850 1:96579063-96579085 CTCTTTCTCCTCCTAGGGTCTGG - Intergenic
911391783 1:97254517-97254539 CTCTTTCTCTTTCTGTTGATAGG - Intronic
911457381 1:98143070-98143092 TTTTTTCTCTTACTGTTGTGAGG - Intergenic
911681136 1:100717303-100717325 CTCTTTTTCTTCCTGGTTTTGGG - Intergenic
912531440 1:110326398-110326420 CTCTTGCTGTTTCTAGTGTCTGG - Intergenic
912750592 1:112283979-112284001 CTCTTTGTCTTCCTGATGTCTGG + Intergenic
915282735 1:154833626-154833648 CCCTTTCTGTTACTGGTGTGTGG - Intronic
915925164 1:160011971-160011993 CTCTTTAGCTTACAGGTGGCTGG - Intergenic
916249293 1:162721313-162721335 TTTTTTCTATTTCTGGTGTCAGG + Intronic
916480835 1:165212947-165212969 CTCTTTCTCTACCTGGTGACTGG + Intronic
917512677 1:175681270-175681292 CTCCTTCTCTTTCTGGGCTCGGG - Intronic
917641127 1:176984065-176984087 CTCTTTCTCTTCCTTGCCTCTGG - Intronic
918247110 1:182670055-182670077 CTCTTTCTCTTACTAAAGTGGGG + Intronic
918644946 1:186893055-186893077 CTTGTTCTCTTCCTGCTGTCAGG - Exonic
918782048 1:188712121-188712143 CTTTTTCTCTTACTAGCTTCTGG + Intergenic
919353263 1:196487306-196487328 CTCTTTCTCTTTCTGAAATCAGG + Intronic
919708113 1:200698323-200698345 CTCCTTCTCTTCCTGGTTTTGGG - Intergenic
923253956 1:232203056-232203078 ATCTTTCTCTTACTGATTTCTGG - Intergenic
923687257 1:236161855-236161877 CTCTTTTTCTTCCTAGTCTCGGG + Intronic
924034464 1:239922293-239922315 ATTTTTCTCTTTCTGGTGCCTGG - Intergenic
924206006 1:241712004-241712026 GTCTTTTTCTTTCTGGCGTCTGG + Intronic
924891860 1:248291286-248291308 CTCTGTCTATTATTGGTGTATGG - Intergenic
1063159640 10:3409922-3409944 CTGTTATTTTTACTGGTGTCGGG + Intergenic
1063869741 10:10404696-10404718 TTCTTCCTTTTACTTGTGTCTGG - Intergenic
1064301983 10:14130997-14131019 TGCTTTCTCCTCCTGGTGTCAGG - Intronic
1064907149 10:20358909-20358931 CTCTTTTTCTTCCAGGTCTCGGG + Intergenic
1066016711 10:31252470-31252492 CTTTTTCTGTCATTGGTGTCAGG + Intergenic
1066294862 10:34045037-34045059 TTCTTTCTCTGACTGCTGTTTGG + Intergenic
1067085520 10:43236009-43236031 CTCTTTCTCATTGGGGTGTCAGG - Intronic
1067191807 10:44076660-44076682 GTCTTTCTCTTATTGCTTTCAGG + Intergenic
1067222174 10:44352317-44352339 CTCTCCCTCTTTCTGGTGCCTGG + Intergenic
1069004184 10:63298700-63298722 TTCTGTCTTTTACTGATGTCGGG - Intronic
1069301849 10:66917640-66917662 ATCTTTCTCCTCCTGGTGACTGG + Intronic
1071218256 10:83432760-83432782 TTCTTTCTCTTGATGGTGTCAGG - Intergenic
1071382607 10:85083256-85083278 CTCTTTCTCTTTCTCCTATCTGG + Intergenic
1073256255 10:102153336-102153358 CTCTTACTCTTACATGTGTTTGG - Intronic
1074448311 10:113538418-113538440 CTTTCTCTCTTCCTGGTTTCTGG - Intergenic
1075303991 10:121351231-121351253 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1075509112 10:123055171-123055193 CTCTTTTTCTTCCTGGTCTCAGG - Exonic
1076397098 10:130147690-130147712 CTCTTTTGCTTACTATTGTCCGG - Intronic
1076783235 10:132735937-132735959 CTCTTTCACAGACTGGTGTGGGG - Intronic
1076980683 11:203065-203087 CTTTTGGTTTTACTGGTGTCAGG + Exonic
1078526323 11:12104287-12104309 CTCTTTCTCTTCTTGTGGTCAGG + Intronic
1078943816 11:16040367-16040389 TTCTTTTTCTTTCTGTTGTCAGG - Intronic
1082216701 11:49579327-49579349 CTCTTTCTCTCACTGGCTTGAGG + Intergenic
1083010552 11:59394039-59394061 ATTTTTTTCTTAATGGTGTCTGG - Intergenic
1084040427 11:66539511-66539533 CTCTGGCTCTTCCTGGAGTCAGG + Exonic
1085369918 11:75992491-75992513 CTCTTTCTCCTACTTATGTTAGG - Intronic
1085628876 11:78096126-78096148 GACTTTCTCCTACTGGTTTCTGG - Intergenic
1087598197 11:100281488-100281510 TTCTTTCTCTTACTGTTTTTAGG + Intronic
1087765514 11:102148654-102148676 TTATTTCTCTTACTGTTCTCTGG + Intronic
1088074721 11:105832816-105832838 CTCCTTCTCTTTCTGGTGTACGG + Intronic
1088329664 11:108637928-108637950 TTCTTTCTCTTAATGTTCTCAGG - Intergenic
1088506131 11:110529315-110529337 CTCTGCCTCTTACTGATGTGTGG + Intergenic
1088642134 11:111882825-111882847 CTTTTTCTCTTACTTCTGTTTGG + Intronic
1088936421 11:114405021-114405043 CTCTTTCTCTTTTTTGTCTCGGG + Intronic
1088943379 11:114483808-114483830 CTCTTTCCCTGATTGGTCTCTGG + Intergenic
1089005616 11:115088234-115088256 CTCCTCCTGTTACTGGTGTTGGG - Intergenic
1089649405 11:119902763-119902785 CTCTTTCTCTTCCCAGTTTCGGG - Intergenic
1089773457 11:120819618-120819640 CTCCTTCTCCCATTGGTGTCTGG + Intronic
1091703695 12:2679923-2679945 CTCCTGCTCTTGCTGGAGTCTGG - Intronic
1091745354 12:2988660-2988682 CCCTTTGTCTTTCTGGAGTCTGG - Intronic
1091878622 12:3958530-3958552 CTCTTTTTCTTCCCGGTCTCAGG - Intergenic
1093163703 12:15780759-15780781 ATCTTTGTATTCCTGGTGTCTGG + Intronic
1093184959 12:16009173-16009195 CTCCTTCTCTTACTGTTGTATGG + Intronic
1093363133 12:18257040-18257062 CTCTTTCTGATAGTTGTGTCAGG - Intronic
1094144079 12:27210711-27210733 CTCTCTCTCTTGCTCCTGTCTGG + Intergenic
1095689391 12:45070007-45070029 CTCTTTTTCTTCCTGGTACCGGG + Intergenic
1095693110 12:45113443-45113465 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1095748443 12:45685440-45685462 CCCACTTTCTTACTGGTGTCAGG + Intergenic
1095968899 12:47888015-47888037 CTCTTTCTCTTCCCAGTCTCAGG - Intronic
1097405324 12:59182326-59182348 CTCTTTCCCTTTCTGGTGCCTGG + Intergenic
1097618717 12:61914324-61914346 CTCTTCCTTTTTCTGGTGTGAGG - Intronic
1098450243 12:70610603-70610625 CTTTTTCTCTTGCTAGTGTCAGG - Intronic
1099029643 12:77510099-77510121 CTCTTTCTCCTATTGGAGTTTGG + Intergenic
1099561126 12:84174703-84174725 CTCTCTCTCTTCCTTCTGTCTGG - Intergenic
1100038908 12:90287811-90287833 CTTTTCCTCTTACTGCTTTCAGG + Intergenic
1100566971 12:95805845-95805867 GTCTTTCTATCACTGGTGCCAGG + Intronic
1100656451 12:96650895-96650917 CTCTTACTCTTGCTGTTGTTTGG + Intronic
1103191573 12:119006338-119006360 CTCCTTCTTTTCCTGGGGTCAGG + Intronic
1104243226 12:127011598-127011620 CTCATTCTATTAATTGTGTCTGG - Intergenic
1104304827 12:127600176-127600198 CTCTTTTTCTTCCCGGTCTCAGG + Intergenic
1105055674 12:133096684-133096706 ATCTTTCTGTTACTGATTTCTGG + Intronic
1105590501 13:21789205-21789227 CTCTTTTTCTTCCGGGTCTCGGG - Intergenic
1106485154 13:30165993-30166015 CTCTTGCTCCTCCTGGTGACTGG - Intergenic
1107083757 13:36404024-36404046 TTCTTTCTCTTACTGCTTTTAGG + Intergenic
1107964468 13:45586838-45586860 CTCTTTCTCTGAGGGGGGTCTGG + Intronic
1109720976 13:66276399-66276421 CTCTTTCTCTTCCTAGTCTCGGG + Intergenic
1109823736 13:67691364-67691386 CTCTTTTTCTTCCTGGTCTCAGG - Intergenic
1109848854 13:68034513-68034535 CTCTCTCTCTGAATGGTGTATGG + Intergenic
1110110718 13:71742225-71742247 CTCTTTTTCTTCCCAGTGTCAGG + Intronic
1112594080 13:100792023-100792045 CTCTTTTTCTTCCCAGTGTCAGG - Intergenic
1112821385 13:103340749-103340771 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1112882513 13:104124366-104124388 CTCTTTTTCTTCCCGGTCTCAGG + Intergenic
1115021160 14:28683299-28683321 CTCTTTTTCTTCCAAGTGTCAGG + Intergenic
1115112632 14:29841659-29841681 CTCTGTTTCTTCCTGGTCTCGGG + Intronic
1117170700 14:53092127-53092149 TTCTTTCTCTTTATGGTTTCTGG - Intronic
1117198340 14:53363237-53363259 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
1119613024 14:76079818-76079840 CACTGTCTCTTACTGGAGGCAGG + Intronic
1119881076 14:78100366-78100388 TTCTTTTTGTTACTGTTGTCAGG - Intergenic
1120157649 14:81111657-81111679 CTCTTACTCTTCCTACTGTCTGG + Intronic
1120798656 14:88665482-88665504 CTCTTTCTCTTTCAGGTGGGAGG - Exonic
1121483669 14:94297352-94297374 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1121881777 14:97507307-97507329 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1122617659 14:103031172-103031194 ATCTTTCTCTGCTTGGTGTCTGG - Intronic
1124039400 15:26086305-26086327 CTCTTTCTTTTGCTGGAATCTGG + Intergenic
1125180365 15:36876167-36876189 CTATTTCTCTCACTGGTGGCTGG + Intergenic
1126266665 15:46762970-46762992 CTCTTTTTCTTCCCGGTCTCAGG + Intergenic
1127362847 15:58260215-58260237 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1127955410 15:63848559-63848581 CTCTTTTTCTTCCTAGTCTCGGG + Intergenic
1128905132 15:71460759-71460781 CACTTTACCTTGCTGGTGTCTGG + Intronic
1129955530 15:79633276-79633298 CTCTTTTTATTAATGTTGTCTGG + Intergenic
1133081723 16:3326648-3326670 ATCTTTCTCTTACTGAGGTTGGG - Intergenic
1133378898 16:5313541-5313563 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1133611423 16:7437090-7437112 CTCTGTGGCTTTCTGGTGTCAGG - Intronic
1133827041 16:9287243-9287265 ACCTTTCTCTTACTGGGATCAGG - Intergenic
1133845068 16:9446033-9446055 CTCTTGGTCTTACTGGTGAAGGG + Intergenic
1133898001 16:9947718-9947740 CTCTTTCTCTTACTGGTGTCTGG + Intronic
1135225160 16:20649549-20649571 CTCTCTCTCTCTCTGATGTCTGG + Intronic
1135999591 16:27281766-27281788 CTCTTTCTCTCACTGGGAGCAGG + Intronic
1137015459 16:35369738-35369760 CTATTTCTGTTACTGGAGGCAGG + Intergenic
1138234519 16:55370790-55370812 CTCATTCTCTTACTGATGGATGG + Intergenic
1140854256 16:78964062-78964084 CTCTTTTTCTTCCCGGTCTCAGG + Intronic
1141754764 16:85983726-85983748 CTCTTTTCCTTCCTGGTGTCTGG + Intergenic
1142559127 17:799626-799648 CTGTTTCTCTTTCGGGGGTCAGG + Exonic
1142907323 17:3052849-3052871 CTCTTTCTCATACTTGCTTCTGG + Intergenic
1142927241 17:3251392-3251414 CTCTTTCTCATACTTGCTTCTGG - Intergenic
1142958950 17:3540374-3540396 CTCTTTCTCTGAATGGTGGGAGG - Intronic
1143713660 17:8752157-8752179 CTCTCTCCCTTCCTGGTGTCTGG + Intergenic
1143715116 17:8762097-8762119 CTCTTTCTCTTCCTAGTCTTGGG - Intergenic
1143982027 17:10878439-10878461 CTCTTTCTCCTGCTTGGGTCTGG - Intergenic
1144028823 17:11301879-11301901 CTCTTTCTCTTCCCAGTCTCTGG - Intronic
1146917152 17:36685423-36685445 CACTTGCTCTTACTGGGGTCTGG + Intergenic
1148973235 17:51503169-51503191 CTCTTTTTCTTAAGGGTTTCTGG + Intergenic
1151056673 17:71039506-71039528 CACTTTCTCTGACTGGTTTAAGG + Intergenic
1152994919 18:397549-397571 TTCTTTCTTGTAATGGTGTCTGG + Intronic
1153447768 18:5193606-5193628 CTCTTTCTCTTCCTGGAATTAGG + Intronic
1153828892 18:8902065-8902087 CTCTTTCTTTTACTTGTTCCAGG - Intergenic
1153859883 18:9191860-9191882 CTGTTTCTCTAATTGGTGCCTGG - Intronic
1155870791 18:31025441-31025463 CTCTCTTTCTTACTGGTTGCTGG - Intronic
1156673436 18:39498778-39498800 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1156865329 18:41882961-41882983 TTCTTTCTTTTAGTGGTGCCAGG + Intergenic
1157043203 18:44063632-44063654 CTCTTTCCCTCGGTGGTGTCTGG + Intergenic
1157046447 18:44106374-44106396 CTCTGTCTATTATTGGTGTATGG + Intergenic
1158986305 18:62820935-62820957 ATCTTTCTTTTATTGGTCTCTGG - Intronic
1159306039 18:66643654-66643676 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1159338851 18:67108016-67108038 ATCTTTCTCTTACTCTTCTCAGG - Intergenic
1159528452 18:69625074-69625096 CTAGTTCTCTTACTGTTTTCTGG + Intronic
1161071868 19:2266523-2266545 CTCTTTCTCTCCCTGCTGTCCGG + Intronic
1164214327 19:23130381-23130403 CTCTTTCTCTTCCCAGTCTCAGG + Intronic
925352855 2:3214239-3214261 CTCTTTCTCTTAGTGTCGTGTGG - Exonic
926059029 2:9793731-9793753 CTCTTTCCTTGACTGGTCTCGGG + Intergenic
926373861 2:12207126-12207148 CTCTCTCTATTACTGGCTTCAGG + Intergenic
927386547 2:22540822-22540844 ATCTTTGACTGACTGGTGTCTGG - Intergenic
927764308 2:25791105-25791127 GTCTTGATCTTCCTGGTGTCTGG + Intronic
929810318 2:45184140-45184162 CTCTTTCTCTTCCTGGAGGCTGG - Intergenic
929969736 2:46563822-46563844 CTCTTTTTCTTAATGGAGACAGG + Intronic
930470495 2:51806195-51806217 CTGTGTCTCTTAATGGTGTGAGG - Intergenic
930735442 2:54774017-54774039 CTCTTTCTCCTCCTGCTGGCTGG - Intronic
931406273 2:61981578-61981600 CTCTTTCTCTTTCCAGTCTCGGG - Intronic
932969966 2:76528602-76528624 CTCATTATCTAACTGTTGTCTGG + Intergenic
934899664 2:98148822-98148844 CTCTTTCTCTTTCTAGTCTGAGG + Intronic
935347340 2:102121006-102121028 CTCTTCCTCTTGCTCCTGTCAGG + Intronic
935557100 2:104521619-104521641 CTTTTTCTCTTACTCCTGCCTGG + Intergenic
935742861 2:106166076-106166098 TTCTTTCTCTTACAGCTGTTTGG - Exonic
936166824 2:110128182-110128204 CTCCTTCTGTTTCTGCTGTCAGG + Intronic
936792112 2:116163176-116163198 TTCTGTATCTTACTGGGGTCTGG - Intergenic
939547607 2:143572325-143572347 CTCAGTGTCTTACAGGTGTCAGG - Intronic
940064121 2:149607693-149607715 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
941545927 2:166851484-166851506 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
942281484 2:174368397-174368419 ATCTTTCTGTTACTGATTTCTGG - Intronic
943116855 2:183683504-183683526 CTCTTTTTCTTCCTGGTCTCAGG - Intergenic
945787076 2:214254096-214254118 CTCTGTCTGTTATTGGTGTCTGG + Intronic
947092090 2:226523443-226523465 GTATTTCTCTTTCTGGTGTCTGG - Intergenic
1168853216 20:990580-990602 CTCTCTCTCTTCCTGGGGTGGGG + Intronic
1169409134 20:5352325-5352347 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1170266796 20:14475793-14475815 CCTTTTCTCTTACTGCTTTCAGG + Intronic
1170849521 20:19992146-19992168 CTCCTTCTCTTCCTGCTCTCAGG + Exonic
1171083336 20:22211137-22211159 CTCTGTCTTTTCCTGGGGTCGGG + Intergenic
1171501605 20:25597978-25598000 CTCTTTTTCTTCCCGGTCTCGGG + Intergenic
1172366715 20:34355669-34355691 CTCCTTCCCTTGCTGGTGACAGG + Intergenic
1172943224 20:38668791-38668813 CTCTTTTTAATACTGATGTCTGG + Intergenic
1174865888 20:54135373-54135395 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1177224646 21:18238269-18238291 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1177334552 21:19706883-19706905 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1179038801 21:37783546-37783568 CTCTTTTTCTTCCTAGTCTCGGG + Intronic
1180036036 21:45250130-45250152 CTATTGCTGTTACTGGTGTTAGG + Intergenic
1181448079 22:22994148-22994170 CTCTTTTTCTTCTTGGTTTCAGG + Intergenic
1181522273 22:23456479-23456501 GTCCTTCTCTGACTGGTTTCTGG + Intergenic
1182117927 22:27768065-27768087 CTGTCTCTCTTTCTGGTGTGGGG - Intronic
1182573997 22:31260569-31260591 CTCTTTCTCCATCTGGTCTCTGG - Intronic
1182951511 22:34380581-34380603 CTCTTTCTCTTGCTGTTTTTTGG + Intergenic
1182994492 22:34800249-34800271 CTCTTTCTCTTTCTGGGATGGGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
949150289 3:758554-758576 CTCATTCTCATTCTGGTTTCAGG - Intergenic
949265825 3:2155306-2155328 CTCTGTCTCTTACAGGGGTGTGG + Intronic
950880269 3:16317581-16317603 CTCTGGCTCTTACTGGGGGCAGG - Intronic
951359059 3:21703120-21703142 CTCTTTTTCTTCCTGGTCTCTGG - Intronic
954631209 3:52048519-52048541 CTCTTTCTCTTGCTGCCGTGTGG - Intergenic
955095893 3:55797575-55797597 ATCTTTCCCTCACTGGTGACTGG - Intronic
955205568 3:56892912-56892934 CCCTTTCAATCACTGGTGTCTGG + Intronic
956524762 3:70145524-70145546 ATCTTTCTCTTATTGGTTTCTGG - Intergenic
957439666 3:80227881-80227903 CTCTTTCTCTCACTCCAGTCTGG - Intergenic
958876992 3:99627713-99627735 TCCTGTCTCTTCCTGGTGTCAGG + Intergenic
959281107 3:104341867-104341889 CCATTTCTCTTCCTGTTGTCAGG - Intergenic
959367677 3:105483349-105483371 ATCTTTCTTTTACTGATATCTGG - Intronic
962045931 3:131758960-131758982 CTCTTTTTCTTCCCCGTGTCAGG + Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
965493511 3:169369117-169369139 CTATTACTCTTACTGCTGTTTGG - Intronic
965532321 3:169785011-169785033 CTGTTTCCCATACTGGAGTCTGG + Intronic
965907738 3:173729986-173730008 CTCTATCTCTGACTTGTGTTTGG + Intronic
965922932 3:173941368-173941390 CCCTTTGTCTTACTGAAGTCAGG + Intronic
966044527 3:175532422-175532444 CCCTTTCATTCACTGGTGTCTGG + Intronic
966299307 3:178461095-178461117 CTCTTTTTCTTACCAGTCTCTGG + Intronic
966308743 3:178569420-178569442 CTCTTTCTCTTACTGTGATTTGG - Intronic
966706959 3:182926631-182926653 CACTTTTTCTCACTGTTGTCAGG - Intergenic
968749961 4:2383472-2383494 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
969072739 4:4552485-4552507 CTCTTTCTCTTCCTAGTCTCGGG + Intergenic
970338994 4:15085274-15085296 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
970343878 4:15134908-15134930 CTCTTTTTCTTCCCAGTGTCAGG - Intergenic
970548013 4:17149180-17149202 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
970550008 4:17170502-17170524 CTCTTTCTCTCTCTGCTTTCAGG + Intergenic
970879014 4:20906130-20906152 CTCTTTCTCTCTCTCTTGTCGGG + Intronic
970977539 4:22058270-22058292 CTCTTTTTCTTCCTGGTCTTGGG + Intergenic
971505087 4:27357980-27358002 CTCTGTTTCTCACTGGTGTGTGG - Intergenic
972011180 4:34184118-34184140 CTCATTCTGATGCTGGTGTCAGG + Intergenic
972061268 4:34876634-34876656 CTCTGTCTATTATTGGTGTATGG - Intergenic
972081331 4:35154056-35154078 CTCTTCTAATTACTGGTGTCAGG + Intergenic
975288598 4:72649789-72649811 CTGTTTCTTTGGCTGGTGTCAGG - Intergenic
976629769 4:87224372-87224394 TTCTTTCTCTTAAAGGAGTCGGG + Intronic
977703908 4:100051060-100051082 CTCTTTTTCTTTCTAGTCTCGGG - Intergenic
977769080 4:100835671-100835693 CTCTTTATCTTACCAGTCTCAGG + Intronic
978667586 4:111204134-111204156 TTCTTTCTCTTAATGTTCTCAGG - Intergenic
980103688 4:128566568-128566590 CTCTTTCCCTGGCTGGTCTCTGG - Intergenic
980202939 4:129678313-129678335 CTCTTTTTCTTTCCAGTGTCGGG + Intergenic
982785064 4:159527379-159527401 CTTTTCCTCTTCCTAGTGTCTGG + Intergenic
983032948 4:162826362-162826384 CTTTTTCTGTTGCTGTTGTCAGG + Intergenic
986397395 5:7344178-7344200 CTCTTTTTCTTCCTAGTCTCTGG + Intergenic
986844450 5:11736339-11736361 CTCTTTCTGTTATTGCTGTAAGG - Intronic
987336986 5:16905745-16905767 TTCTTACTTTTACTGGTGGCAGG - Intronic
987732751 5:21798675-21798697 CTCTTTCTCTTTCTGCTGTGTGG + Intronic
989614366 5:43324684-43324706 CTCTGTCTGTTATTGGTGTATGG + Intergenic
990856738 5:60275945-60275967 ATCTTTCTCTTATTGATTTCTGG + Intronic
991258597 5:64642657-64642679 CTCTTTCTCTTCCTGTAGTTAGG - Intergenic
991259765 5:64654015-64654037 CTCTTTCTCTATGTGGTTTCAGG - Intergenic
991405752 5:66299873-66299895 CTCTTTCACTTACTACTGTGTGG - Intergenic
991520359 5:67490541-67490563 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
992379915 5:76226960-76226982 CTCTTTCTCTCTCTGGTCCCTGG - Intronic
992733073 5:79691323-79691345 ACCTTTCCCTTACTGTTGTCTGG + Intronic
993647343 5:90476782-90476804 CTCTTTGCCTTACTTTTGTCAGG + Intronic
993655925 5:90577911-90577933 CTCTGTCTATTATTGGTGTATGG + Intronic
995131218 5:108632449-108632471 CTATTTTTCTTTTTGGTGTCTGG + Intergenic
996526992 5:124490128-124490150 CTCTTTTTCTTCCCGGTCTCGGG - Intergenic
1000500457 5:162042348-162042370 TTCTGTCTCTGAATGGTGTCAGG - Intergenic
1001795660 5:174500009-174500031 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1001942002 5:175747144-175747166 CTCTTTCTCTTCCTTCTGCCTGG + Intergenic
1002666178 5:180827138-180827160 CTGTTTCTCTTTCGGGTGACAGG + Intergenic
1004327059 6:14684817-14684839 CTCTTCCTTTTACTGTTGTTTGG - Intergenic
1009267994 6:61580203-61580225 CTCTTACTTTTACTGGTGGCTGG - Intergenic
1009329543 6:62399852-62399874 TTCTTTCTCTTAGTGCTTTCAGG + Intergenic
1010192930 6:73212016-73212038 CTCCTTCTCTTACTTGAGTAGGG - Intronic
1010291227 6:74140271-74140293 CTCTTTCTCTGAATGATGTGGGG + Intergenic
1010374987 6:75157578-75157600 CCCTTTCTTTTACTGGGGACTGG - Intronic
1010411727 6:75568683-75568705 CTCTTTTTCTTCCTAGTCTCGGG - Intergenic
1010849815 6:80759558-80759580 TTCTTTCTCTTGCTGATTTCAGG + Intergenic
1011284393 6:85707594-85707616 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1011317092 6:86046932-86046954 CTCTTTCTTTTCCTGGTCTCTGG + Intergenic
1013717088 6:112975214-112975236 CTCTTTTTCTTCCTGGTCTTGGG + Intergenic
1013863301 6:114661571-114661593 CTCTTTTTCTTCCCAGTGTCGGG + Intergenic
1014094209 6:117442396-117442418 CTCTTTTTCTTCCCGGTTTCAGG - Intronic
1014351559 6:120352527-120352549 CTCTTTCTCTTTCTTGTTACTGG - Intergenic
1015099699 6:129462091-129462113 CCTTTGCTCTTACTGGTTTCAGG - Intronic
1015305851 6:131706970-131706992 CTCTCTCTTTTACTGTTTTCTGG + Intronic
1015392097 6:132694154-132694176 GTCTTTCTTGTACTGGGGTCTGG + Exonic
1015490800 6:133823472-133823494 CTCTTTTTCTTCCTAGTCTCTGG - Intergenic
1018182199 6:161234015-161234037 CTCTTTCTCCTGCACGTGTCAGG + Intronic
1018307934 6:162477872-162477894 CTCTATCTCTTGCTGTTGTTTGG + Intronic
1019115368 6:169756874-169756896 CTCTTTCTCTTCCTAGTCTTGGG - Intronic
1019589061 7:1820111-1820133 GTCTTTCTCTGACTGGTTTCTGG - Intronic
1019812239 7:3173262-3173284 CTCTTTCTTTTTCTGGTTACTGG + Intronic
1020521546 7:9194545-9194567 CTCTTTCACTGACCAGTGTCTGG + Intergenic
1020878525 7:13728706-13728728 CTCTTTTTCTTCCTGGTCTCTGG + Intergenic
1022397287 7:30000688-30000710 CTCTTTTTCTTCCCGGTTTCAGG - Intergenic
1022902434 7:34824546-34824568 GTTTTTCTCTTACTGGTGCTGGG - Intronic
1023070912 7:36432282-36432304 CTGATTTTCTTAATGGTGTCTGG + Intronic
1024056019 7:45660343-45660365 CCTTGTCTCTTACTGGTGTGGGG + Intronic
1024097800 7:45998723-45998745 ATCCTTCTGTTACTGGTTTCTGG - Intergenic
1024105986 7:46087144-46087166 CTCTGTCTATTATTGGTGTATGG + Intergenic
1024149857 7:46559966-46559988 CTCTTTCTTTTACTAGTATGAGG - Intergenic
1024184057 7:46930543-46930565 CTCTCTCTCTTCCTTGTGTGCGG - Intergenic
1024363594 7:48495354-48495376 GTCTTTCTGTTACTGATTTCTGG + Intronic
1024916456 7:54505118-54505140 ATCTTTCTGTTATTGGTTTCTGG + Intergenic
1024938048 7:54732346-54732368 TTCTTTCTCTTACTCCTGCCTGG + Intergenic
1027112266 7:75449660-75449682 CTCTTTCCCCTACTGTTGCCGGG - Intronic
1027244469 7:76358296-76358318 CTCTTTCTCTCCCTGGTGTCTGG - Intronic
1027284499 7:76634202-76634224 CTCTTTCCCCTACTGTTGCCGGG - Intergenic
1027922741 7:84416394-84416416 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1028942329 7:96536242-96536264 ATCTTTCTGTTACCGGTTTCTGG + Intronic
1030660755 7:112216706-112216728 CTCTTTCTTTTACTGATATTTGG - Intronic
1032533373 7:132639909-132639931 CCCTTTCTCTAACTGGCTTCGGG + Intronic
1033662523 7:143412170-143412192 CTCTTTCCCCTTCTGGCGTCTGG + Intergenic
1033739967 7:144265203-144265225 CTCTCTCTTTTACTGTTTTCTGG + Intergenic
1034414549 7:150957697-150957719 CTCTTCCTCTTCCTGGTCTCAGG - Intronic
1034561806 7:151885168-151885190 ATCTTTCACCAACTGGTGTCCGG + Intergenic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1035228389 7:157445927-157445949 CTCTTCCTCTTACAGGTCACAGG - Intergenic
1035407778 7:158611025-158611047 CTGTTTCTGTTACAGCTGTCAGG - Intergenic
1037137837 8:15484556-15484578 CTCTTTCTCATTCCGGTGTAGGG + Intronic
1038138921 8:24821695-24821717 CTCTTTTTCTTCCTAGTTTCGGG + Intergenic
1038722120 8:30046576-30046598 CTCTTTCTCTTCCTCATATCAGG + Intergenic
1038924347 8:32121709-32121731 CTCTTTCTCTCTCTGATTTCTGG - Intronic
1040599843 8:48872350-48872372 CTCTTTCTCTTATTGGTCAGGGG - Intergenic
1041480456 8:58314643-58314665 CTCTTTAACTTACAGGTGTGTGG - Intergenic
1041526431 8:58812018-58812040 CTCTCTCTCTGTCTGGTGTTTGG + Intronic
1042080718 8:65047876-65047898 CTATTTTTCTTACTAGTGTCAGG - Intergenic
1042953436 8:74224438-74224460 CTCTTTTTCTTCCCAGTGTCAGG - Intergenic
1043272054 8:78346860-78346882 GTCTTTCTGTTACTGATTTCTGG - Intergenic
1043466271 8:80510598-80510620 CTATTTTTCTGACTGGTGGCAGG - Intronic
1043974682 8:86571160-86571182 CTCTTTTTCTTTCTAGTTTCGGG + Intronic
1044071980 8:87772277-87772299 CTCTTTATCTTACTGGCCTTTGG - Intergenic
1046927216 8:119804684-119804706 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1046933457 8:119864075-119864097 CTCTTTCTCTTACTTAGGGCAGG - Intergenic
1046972067 8:120234111-120234133 CTCTGTCTATTATTGGTGTATGG + Intronic
1047216919 8:122883362-122883384 CCCTTACTCTTGCTGCTGTCTGG - Intronic
1047286511 8:123491889-123491911 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1047996501 8:130341780-130341802 CTGTTTCTCTTTTTGGTGCCAGG - Intronic
1050228694 9:3492920-3492942 TTCTTGCTCTTATTGGTGTCGGG + Intronic
1050549328 9:6735699-6735721 CTCTTTTTCTTCCCAGTGTCAGG + Intronic
1050948360 9:11555495-11555517 CTCCTTCTGTTATTGGTTTCTGG + Intergenic
1052018072 9:23492578-23492600 CTCTTTCTCTTTCTCATATCTGG - Intergenic
1052531698 9:29692998-29693020 TTCTTTCTCTTAATGTTTTCAGG - Intergenic
1052576169 9:30294076-30294098 CTCTGTTTCTTCCTGGTCTCAGG - Intergenic
1055175418 9:73312906-73312928 CTCTTTTTCCTTCTGGTTTCAGG - Intergenic
1055437847 9:76310351-76310373 CTCTATGTCTTCCTGGTGTAAGG - Intronic
1055552741 9:77446222-77446244 CTCATTCTCTTTCTGGTGTTGGG + Intronic
1056976563 9:91261675-91261697 CTCTTTCTTTCACTGTAGTCTGG + Intronic
1057571093 9:96204629-96204651 CTCTGTCTATTCTTGGTGTCTGG - Intergenic
1057714247 9:97477619-97477641 CTCATTCTCTTAGTGATGTATGG + Intronic
1057942964 9:99300729-99300751 CTCTTTCTGTCTCTGGTGTTAGG + Intergenic
1058418245 9:104810562-104810584 CTCTTCATCCTACTGTTGTCAGG - Intronic
1058846395 9:108963936-108963958 GTCTTTCTCAAACTGGTGTTAGG - Intronic
1058993574 9:110277891-110277913 CTGTTTCTCTTTCTGGCTTCTGG - Intergenic
1059381001 9:113924838-113924860 GTCTTTCTCTTATTGATTTCTGG + Intronic
1060547005 9:124467802-124467824 TTCTTGCTCTTCCTGGTGGCCGG + Exonic
1186212984 X:7269615-7269637 CTCTTTATATTTCTGGTGCCTGG + Intronic
1186266471 X:7839611-7839633 CTCTTTTTCTTCCTAGTCTCAGG - Intergenic
1186368541 X:8921935-8921957 GTTTTTCTCTTGCTGGGGTCTGG + Intergenic
1186759178 X:12705304-12705326 CTCCTTCTCTTTCTGGTTCCTGG - Intronic
1187668407 X:21641973-21641995 CCCTCTCTTTTCCTGGTGTCAGG - Intronic
1188123485 X:26338322-26338344 CTCTGTCTGTTATTGGTGTATGG - Intergenic
1189985119 X:46546444-46546466 CTCTTTCTCTTTCTCCTCTCAGG + Intergenic
1190923252 X:54877525-54877547 CTCTTTCAATAATTGGTGTCAGG - Intergenic
1191646088 X:63482660-63482682 CTCTGTCTGTTAATGGTGTATGG - Intergenic
1191856289 X:65629546-65629568 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1192309312 X:69996981-69997003 CTCTTTTTCTTCCTAGTCTCAGG + Intronic
1192887036 X:75346762-75346784 CTCTTTTTCTTCCTAGTCTCAGG + Intergenic
1193228052 X:79009219-79009241 CTCTGTCTATTATTGGTGTATGG + Intergenic
1194307904 X:92271156-92271178 CTCTTTTTCTTCCTGGTGCAGGG + Intronic
1195941636 X:110172453-110172475 CTCTTCCTCATTCTGGTGTATGG + Intronic
1196536685 X:116853658-116853680 CTCTTTCAGGTATTGGTGTCAGG + Intergenic
1196890440 X:120286085-120286107 CTATTTCTCTCACTGTTCTCAGG - Intronic
1197859532 X:130955694-130955716 ATCTTTCTGTTACTGATTTCTGG + Intergenic
1198224790 X:134635341-134635363 CTCTTTCTCTCTCTGGAGACAGG + Intronic
1199800185 X:151242900-151242922 TTCTTTCTCATACAGGTGTGTGG + Intergenic