ID: 1133899396

View in Genome Browser
Species Human (GRCh38)
Location 16:9959308-9959330
Sequence CTAGGTTTAGGGATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133899396 Original CRISPR CTAGGTTTAGGGATGGAAGC TGG (reversed) Intronic
900001403 1:16826-16848 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900021123 1:187348-187370 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900099788 1:956902-956924 CATGGTTGAGAGATGGAAGCAGG - Exonic
900782793 1:4628874-4628896 CTAGGGTTAGGGGTGGAGGAGGG + Intergenic
901656985 1:10775026-10775048 CTAGGGTTGGGGCTGGAAACCGG + Intronic
903861493 1:26367509-26367531 CTAGGTTTGGGGATGGGTGGTGG - Intronic
904278021 1:29396835-29396857 CTAAGTTTAGGGCTTGGAGCAGG + Intergenic
904287458 1:29461582-29461604 CTAGGCTCAGGGGTGGAGGCTGG - Intergenic
904370719 1:30045948-30045970 CTGGGCTCAGGGATGGAGGCTGG - Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
906087928 1:43151883-43151905 CTAGGGTAAAGGATGCAAGCTGG + Intronic
906248860 1:44296009-44296031 CTAGGTTTAGGGAGGGGGCCAGG + Intronic
907507234 1:54928518-54928540 CTAAGTTTAGAGGTGGAATCTGG - Intergenic
907714973 1:56917837-56917859 CTAGTCTTAGGCCTGGAAGCTGG - Exonic
911102951 1:94108275-94108297 CTAGGTCAAGGGCTAGAAGCAGG - Intronic
911443473 1:97961048-97961070 CTAGTTTTTGGTCTGGAAGCTGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915457776 1:156052117-156052139 CTAGGTGGAGGGACTGAAGCTGG - Intronic
915819452 1:159006269-159006291 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
915937635 1:160098549-160098571 CCAGGTTGAGGGCAGGAAGCGGG + Exonic
916739118 1:167632616-167632638 CTAGGGTTTGGGAGGGACGCAGG + Intronic
922969961 1:229727976-229727998 TGTGGTTTAGGGAGGGAAGCAGG - Intergenic
923120392 1:230984641-230984663 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
1062874681 10:933372-933394 CTGGGATTAGAGATGGGAGCCGG + Intergenic
1063376025 10:5554860-5554882 GTAGCTTTAGAGATGGAGGCAGG - Intergenic
1064751683 10:18536988-18537010 CTAGGTTTAGTTTTGGAGGCAGG + Intronic
1065466621 10:26031251-26031273 CCAGGTTTAGTCATGAAAGCCGG + Intronic
1065972242 10:30814934-30814956 CCAGGTTTAGGGATTGAATCAGG - Intergenic
1068678324 10:59791260-59791282 CTCAGTTTGGGGGTGGAAGCAGG + Exonic
1068771042 10:60820894-60820916 CTAGGTTCAGTGTTAGAAGCTGG + Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070151304 10:73806885-73806907 CAAGGATCAGGGATGGAAGGTGG - Intronic
1071876094 10:89844842-89844864 ATAGATTCAGGGAAGGAAGCAGG + Intergenic
1073111361 10:101064851-101064873 CCAGGTTTAGTGATCGCAGCTGG - Exonic
1074543493 10:114385122-114385144 GAAGGTGAAGGGATGGAAGCAGG + Intronic
1074789587 10:116873363-116873385 CTATGTTCAGGGATGGTACCTGG - Intronic
1075572891 10:123558390-123558412 CGAGGTTCAGAGATGGCAGCAGG + Intergenic
1077555495 11:3224095-3224117 GTGGGTTTAGGGTTGGCAGCTGG + Intergenic
1079301928 11:19286038-19286060 GCAGGTACAGGGATGGAAGCGGG + Intergenic
1082672800 11:56056228-56056250 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1083935948 11:65870232-65870254 CTATGTCTAGGGATAGAGGCAGG + Exonic
1084941435 11:72615334-72615356 CTAGGTTTGGGGGTGGATGAAGG + Intronic
1085311555 11:75520025-75520047 CTAGGTTCAGGGGAGGGAGCAGG - Intronic
1087398771 11:97637285-97637307 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1092671980 12:10873587-10873609 CTAGCTTTAAAGATGGAAGAGGG - Intronic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1099518811 12:83632990-83633012 CAAGATTTAGGGATTGAAGAAGG - Intergenic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100476623 12:94941135-94941157 CTGGAATTAGGGATGGAAGAAGG - Intronic
1102757986 12:115358961-115358983 CTAGTTAGTGGGATGGAAGCAGG - Intergenic
1102788822 12:115626498-115626520 CTGTGTTTAGGGATGGAATTTGG - Intergenic
1103781633 12:123402655-123402677 CCAGGGTTAGGGATGGAGGTAGG + Intronic
1104487095 12:129161124-129161146 ACAGGTTTGGGGAAGGAAGCAGG - Intronic
1106926102 13:34614803-34614825 CTAGGTTTTGGGAAAGAAGGTGG - Intergenic
1108536934 13:51392453-51392475 CTAGGTTTAGAGAGGTAGGCAGG - Intronic
1109207844 13:59501414-59501436 GGAGGTCTAGGGATGGAAACTGG - Intergenic
1110718758 13:78737930-78737952 CAAAATTTAGGGATGGGAGCGGG - Intergenic
1114847237 14:26337858-26337880 CCAGGTTTGGAGATGGAGGCAGG + Intergenic
1117351100 14:54882966-54882988 CTATGTGTAGGGATGGACCCAGG + Intronic
1119411944 14:74437698-74437720 CAAGGTATAGGGGTGGGAGCTGG - Intergenic
1121065189 14:90957021-90957043 CCAGGGTTGGGGATGGAAGTAGG - Intronic
1121478775 14:94241882-94241904 CTAGGATTTGGGGTGGAATCTGG - Exonic
1123152578 14:106197128-106197150 CTAGGTTTAGGAAGGGGAGAGGG + Intergenic
1127387007 15:58474961-58474983 ATAGGTGGAGGGATGGTAGCTGG - Intronic
1127512578 15:59657366-59657388 GCAGGGTTAGGGAGGGAAGCAGG - Intronic
1127816203 15:62611333-62611355 CTAGGCTCAGGTATGGATGCTGG + Intronic
1128078509 15:64842652-64842674 CTAGCTGTAGGGAAGGAATCGGG + Intronic
1128706109 15:69838433-69838455 CCAGGGTTAGGGGTGGGAGCTGG - Intergenic
1132452105 15:101974112-101974134 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1132454788 16:16509-16531 CTGGGTTCTGGGATGGGAGCTGG - Intronic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1138383380 16:56618860-56618882 CCAGGGTTAGGGATTGAACCTGG + Intergenic
1140997202 16:80272504-80272526 GTAGGTATAGAGATGAAAGCAGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141577507 16:84973686-84973708 CTTGGCTTGGGTATGGAAGCAGG - Intergenic
1142012143 16:87720974-87720996 CCAGCTTCAGGTATGGAAGCAGG - Intronic
1148136353 17:45294422-45294444 CTAGGTTCAAGGATGGATTCAGG + Intronic
1148291804 17:46458480-46458502 CTGGGTTCTGGAATGGAAGCTGG + Intergenic
1148313994 17:46676185-46676207 CTGGGTTCTGGAATGGAAGCTGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152587621 17:81196075-81196097 CTAGGTTTGTGGATGGACCCTGG + Intronic
1152869408 17:82743965-82743987 CCAGGTTTAGTGCTGGAAGCAGG - Intronic
1154005317 18:10522625-10522647 CTAGGCTAGGGGAAGGAAGCAGG + Intergenic
1155032783 18:21998760-21998782 CTGGGTGTAGGGATGGCAGGGGG + Intergenic
1156443672 18:37218044-37218066 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
1157013650 18:43682567-43682589 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1160180707 18:76633496-76633518 CTAAAATTAGGAATGGAAGCAGG + Intergenic
1160529539 18:79555427-79555449 CAAGCTTGAGGGAGGGAAGCCGG - Intergenic
1161654488 19:5505717-5505739 CTTTGTTTAGTGATGGCAGCTGG + Intergenic
1166137854 19:40788031-40788053 CAAGGTCTAGGGCAGGAAGCTGG - Intronic
1166975423 19:46602465-46602487 CTAGGTTTGGGGGTGGATGTGGG + Intronic
1167456456 19:49598834-49598856 CTGGGTTTAGGGAGAGAGGCAGG + Intronic
1168673118 19:58256441-58256463 CTAGGTTTAGGAAGGGGAGAGGG + Intronic
927069386 2:19510591-19510613 CTAGGTTTAGCAAAAGAAGCAGG + Intergenic
928807413 2:35176517-35176539 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
930079571 2:47434621-47434643 CCAGTATTAGGGATGGAATCAGG + Intronic
930608507 2:53516677-53516699 ATAGGTTTAGGAAGGGAAACTGG - Intergenic
930905344 2:56559507-56559529 CTCGTCTTATGGATGGAAGCAGG + Intergenic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
931766743 2:65463571-65463593 CTGGGCTTGGGGATGGGAGCTGG + Intergenic
932599595 2:73114279-73114301 CAAGATTGAGGGATGGAAGTGGG - Intronic
932722694 2:74149279-74149301 CCAGCTTTAGGAATGGAAACAGG + Intergenic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
936009238 2:108914789-108914811 CTTGATTTGGGGATGGCAGCTGG - Intronic
936229579 2:110688454-110688476 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
936568322 2:113596588-113596610 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
936735707 2:115440623-115440645 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
936801174 2:116268648-116268670 CTAGGTTTAGGAAAGGGAGGGGG - Intergenic
937219165 2:120331788-120331810 CCAGGTTCAGGGATGGAAAAAGG - Intergenic
938303097 2:130229822-130229844 CATGGTTGAGAGATGGAAGCAGG + Intergenic
938453574 2:131444407-131444429 CATGGTTGAGAGATGGAAGCAGG - Intergenic
939875946 2:147577920-147577942 CTTGGTGGAGGGATGGAAGTAGG - Intergenic
941753424 2:169159063-169159085 CTAGGTTTGGGGATAGATGGAGG - Intronic
943713516 2:191124664-191124686 TTAGGTTTAGGGAGGGAGGTGGG - Intronic
944903939 2:204244061-204244083 CTAGGACTAGGGAGTGAAGCAGG - Intergenic
945646837 2:212506735-212506757 TGAGGTTTAAGGATAGAAGCTGG + Intronic
1171241306 20:23569119-23569141 CAAGGTTTAGAAATGCAAGCAGG - Intergenic
1172659904 20:36560600-36560622 CTGGGTTGAGGGATGGGAGAAGG - Intergenic
1172707786 20:36895292-36895314 CTGGGTTAAGGGCTGGCAGCAGG - Intronic
1172807780 20:37625130-37625152 CTAGGTTTGGGCCTGGAAGATGG + Intergenic
1173487663 20:43453313-43453335 TTAAATTTAGGAATGGAAGCTGG - Intergenic
1177157287 21:17512757-17512779 TTAGCTTAAGGGATGGAGGCGGG + Exonic
1177559595 21:22732298-22732320 CTTGGTCTAGGGATGAAAGTGGG + Intergenic
1180845336 22:18978209-18978231 CCAGGTTTAGTGTTGGGAGCAGG + Intergenic
1180846270 22:18984160-18984182 CCAGGTTTAGTGTTGGGAGCAGG - Intergenic
1181507203 22:23367677-23367699 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1182021916 22:27088772-27088794 TGAGGTTGAGGGATGGAAGGTGG - Intergenic
1182895582 22:33856555-33856577 CTAAGTTTAGGGCTGTAATCCGG - Intronic
1185355027 22:50363251-50363273 CTAAGTGTAAGGAAGGAAGCTGG - Intronic
949577842 3:5356052-5356074 CTGGGATTAGGGATGGAGACTGG - Intergenic
950598311 3:14006223-14006245 CTAGGATTAGGGATGAAAGAGGG - Intronic
951154419 3:19332260-19332282 GTAGGGTTAGGGATGGTAGAGGG - Intronic
952131587 3:30370373-30370395 CGAGGTTGAGGGGTGGAAGATGG - Intergenic
952878528 3:37968531-37968553 CTAGCTTTAGAGGTTGAAGCTGG + Intronic
953227015 3:41030267-41030289 CCAGCTTTAGGGAAGGGAGCTGG + Intergenic
953735323 3:45489340-45489362 GTAGGGTGAGGGATGGGAGCAGG + Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
960107029 3:113808914-113808936 CTAGGTTTAGTGAGGGACACTGG - Intronic
960622946 3:119653972-119653994 CTAGGCTGTGGGGTGGAAGCTGG + Intronic
961837633 3:129676898-129676920 CCAGGTTAAGTGATGGAAGAAGG - Intronic
963026017 3:140919436-140919458 TTAGGTTTAGTGAAGGAAGCTGG - Intergenic
969295273 4:6266491-6266513 ATAGGTGTAGGGAAGGAAGTGGG + Intergenic
969474644 4:7414590-7414612 CTAGGTTTAGGAAGGGGAGGGGG + Intronic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
974010840 4:56606007-56606029 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
976779058 4:88738378-88738400 CTGGGATGAGGGATGGGAGCAGG + Intronic
978823813 4:112996255-112996277 CTGGGAATAGGGATGGGAGCAGG + Intronic
980788606 4:137588133-137588155 CTAGGTTTGGGTATGGATACAGG + Intergenic
981737657 4:147969952-147969974 TTGGGTTTAGGGTTGGAAGCAGG + Intronic
984111827 4:175626604-175626626 GGAGGTTTAAGAATGGAAGCAGG + Intergenic
989511249 5:42289969-42289991 CCAGGAATAGAGATGGAAGCTGG - Intergenic
989759240 5:44992325-44992347 GTAGGTTAAGGGATGGAAAGGGG - Intergenic
990533184 5:56694261-56694283 GAAGCTTTAGGGTTGGAAGCAGG - Intergenic
990735190 5:58852763-58852785 CTAGGATTTAGGAAGGAAGCAGG + Exonic
992504802 5:77376194-77376216 CTAGGACTAGGGATGGCTGCAGG + Intronic
994203120 5:97001402-97001424 GTAGGTTTAGGGAAAGAAGGGGG + Intronic
994681199 5:102889483-102889505 CTAGGTTAAGGGAAGCATGCAGG - Intronic
994766747 5:103928072-103928094 CTAGGTTTAGGCATAGGAGGAGG - Intergenic
995597172 5:113760253-113760275 CAAGGTTTAGGGATGCAAGCAGG - Intergenic
999571189 5:152921499-152921521 CTAGGGTGAGGAATGGAAGTTGG + Intergenic
1001823948 5:174731335-174731357 CTGGGCTGGGGGATGGAAGCCGG + Intergenic
1002879363 6:1237919-1237941 CTAGGATTAGGGATAGAAGGAGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1005599710 6:27413830-27413852 CTAAGTTTAGGGTTTGAAACTGG + Intergenic
1006061655 6:31424994-31425016 CAGGGGTTAGGCATGGAAGCGGG - Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1007415174 6:41687465-41687487 CTGGGTTAAGGCATGGAACCTGG - Intronic
1007977455 6:46115894-46115916 GTATCTTCAGGGATGGAAGCTGG + Intergenic
1009773983 6:68180868-68180890 CTAGGTTTAGGAAGGGGAGGGGG + Intergenic
1012212211 6:96533554-96533576 CTAGATTTAGGAGTGGCAGCAGG + Intronic
1014632343 6:123803206-123803228 GGAGGGTTAGGGAAGGAAGCTGG - Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1018904005 6:168064737-168064759 CAAGGGTCAGGGATGGAAACAGG - Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1019012219 6:168851028-168851050 AGAGGTGAAGGGATGGAAGCAGG - Intergenic
1019324643 7:432152-432174 CTGGGTTCAGGGCTGGAAGATGG + Intergenic
1019900906 7:4020049-4020071 ATAGGTTTAGGGTTGGAGTCAGG - Intronic
1020979991 7:15054799-15054821 CTTGGTTTAGGAAGGGGAGCGGG - Intergenic
1022889371 7:34681156-34681178 CTTGGTCTGGGGATGGAGGCAGG - Intronic
1025099210 7:56121604-56121626 GGAGGTGTAGTGATGGAAGCAGG + Intergenic
1026096785 7:67352851-67352873 CTAGGTTTAGGGTTATGAGCAGG - Intergenic
1028413542 7:90556773-90556795 ATATCTTTAGGGATGGAAGGAGG - Intronic
1028831262 7:95328697-95328719 GTAGGTTAAGGGAAGGAAGGAGG - Intergenic
1029130021 7:98322735-98322757 AGAGGATGAGGGATGGAAGCAGG - Intronic
1031661914 7:124436153-124436175 CTAAGGTCAGGGATGGAATCTGG + Intergenic
1035934581 8:3822226-3822248 AGAGGTTAAGTGATGGAAGCAGG - Intronic
1039190415 8:34967458-34967480 CTAGGTTTTGGGAGGGATTCAGG + Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1046821757 8:118641521-118641543 CTAGGGTTGGGGATGGAAGCAGG + Intergenic
1048694006 8:137003611-137003633 CTAGATTTAGAGATGTAAGCAGG - Intergenic
1049884208 9:16937-16959 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
1051191577 9:14518585-14518607 TTAGGAGTAGGGATGGAAGGTGG - Intergenic
1185576077 X:1173426-1173448 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1188078841 X:25811614-25811636 CTAGGTTTAGGTTTGGAACTTGG - Intergenic
1192605981 X:72518276-72518298 CTGGGTCTAGGGATGACAGCAGG - Intronic
1194758405 X:97765014-97765036 GTATGTTTAAGGAGGGAAGCTGG + Intergenic
1195274705 X:103270330-103270352 CTTGGTTTAGGAAAGGAAACTGG + Intergenic
1195589863 X:106612041-106612063 CTAGCTTTTGGGAGTGAAGCGGG + Exonic
1197519502 X:127479597-127479619 CTAGATTGACAGATGGAAGCAGG + Intergenic
1199521835 X:148744848-148744870 CTAGGATTAAGAATGGAAGCAGG - Intronic
1200401595 X:156023219-156023241 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1200757548 Y:7004134-7004156 GTTGTTTTAGGGATGGAAGCTGG + Intronic
1200845795 Y:7831408-7831430 CTAGGTTTAGGAAGGGGAGGGGG - Intergenic
1201754303 Y:17469524-17469546 TTAGGATTAGGGGTAGAAGCAGG + Intergenic
1201847249 Y:18436461-18436483 TTAGGATTAGGGGTAGAAGCAGG - Intergenic