ID: 1133901087

View in Genome Browser
Species Human (GRCh38)
Location 16:9975510-9975532
Sequence ATTTATTTGCAGTCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133901087_1133901091 4 Left 1133901087 16:9975510-9975532 CCATCCACAGACTGCAAATAAAT 0: 1
1: 0
2: 2
3: 24
4: 284
Right 1133901091 16:9975537-9975559 ACCTCAGTTCCACAACTCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133901087 Original CRISPR ATTTATTTGCAGTCTGTGGA TGG (reversed) Intronic
900290578 1:1921973-1921995 ATTTATTGACAGGCTGTGGAGGG + Exonic
901334802 1:8440199-8440221 AACTATTTGTAGTATGTGGAAGG + Intronic
904306516 1:29593621-29593643 TTTTTTTTGCAGTTTATGGAGGG + Intergenic
904373275 1:30064388-30064410 ATTTCTCTGCAGTGTGTGGGTGG + Intergenic
904458925 1:30663945-30663967 ATTTGTTTTCAGCCTGTGGTAGG - Intergenic
907174914 1:52511108-52511130 ATTTATTTTTAGTCTGTAGCAGG - Intronic
908772973 1:67612918-67612940 ATTTTTTTACAGTCTATGGATGG - Intergenic
909569291 1:77089767-77089789 ATTCATTTGCAGTTTATGAAAGG - Exonic
912053433 1:105562719-105562741 TTTTATTTTTAGTCTGTGGTCGG - Intergenic
915749234 1:158189329-158189351 ATTTATTTGAAGTCTGGAGATGG + Intergenic
916038128 1:160938997-160939019 ATTTAAAGGCAGTGTGTGGAGGG - Intergenic
917334177 1:173911538-173911560 ATATATTTGAAGTTGGTGGATGG + Intronic
917670519 1:177269424-177269446 ATTTAGTTGAAGGCTGAGGAAGG + Intronic
918634048 1:186753743-186753765 ATTTATTAGCCTTCTGTGTAGGG + Intergenic
919067561 1:192712825-192712847 ATTTGTCTTCTGTCTGTGGATGG - Intergenic
919967101 1:202538771-202538793 ATTTATTTGCATAGTGTTGAAGG - Intronic
921232944 1:213092193-213092215 GATCATCTGCAGTCTGTGGATGG + Intronic
921647209 1:217632794-217632816 ATTTATTTAGAGTATGTGGCAGG + Intronic
922995893 1:229961040-229961062 ATATATTTTCAGTCTGAGGTTGG + Intergenic
924143596 1:241050955-241050977 ATTTATTTGCAGATTTTTGATGG + Intronic
1064716643 10:18183404-18183426 CTTTATTTGCAGTGTGAGGATGG - Intronic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1065011821 10:21427803-21427825 ATGTAGCTGCAGTCAGTGGATGG + Intergenic
1066929699 10:41741819-41741841 ATTTTTGTGCAATCTGTGAATGG + Intergenic
1069892016 10:71657867-71657889 CTTTATCTGCAGCCTGGGGAGGG + Intronic
1072111138 10:92321286-92321308 ATCTATTTGTAGTTTGTTGAGGG + Intronic
1072355518 10:94605942-94605964 TTTGATTTCCAGTCTGTTGAAGG + Intronic
1074253169 10:111774192-111774214 ATGTATTTGCAGTCAGCTGAAGG - Intergenic
1079694889 11:23469235-23469257 ATTTATTCTCAGTAAGTGGATGG + Intergenic
1080435338 11:32235765-32235787 ATTTATGTTCAGTCTTTGGGTGG - Intergenic
1081255458 11:40888341-40888363 ATTTGTTTCCAGTAAGTGGAAGG + Intronic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1084071820 11:66741580-66741602 ATTTATTGGCAGTGTCTGTAGGG - Intergenic
1085981167 11:81728313-81728335 ATTTTTTTGCAGTGTGGGGATGG + Intergenic
1087861332 11:103161228-103161250 ATGGATTTGTAGTCTTTGGAAGG + Intronic
1087917055 11:103823235-103823257 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1088209472 11:107438678-107438700 AAAAATTTGCAGTCTTTGGAAGG - Intronic
1089770551 11:120799397-120799419 GTTCATTTACAGTCTGTAGATGG + Intronic
1089857447 11:121558973-121558995 ACTTATTTTCAGCCTATGGAGGG + Intronic
1089865780 11:121630048-121630070 ATTTATTGGGACTCTGTGTAAGG + Exonic
1089897302 11:121943656-121943678 ATTTATTTGCATACTGTTTATGG - Intergenic
1089916366 11:122160923-122160945 ATTTAGTTGCAATCCTTGGACGG + Intergenic
1089940001 11:122406378-122406400 AAGTATTTGCCGTATGTGGAGGG - Intergenic
1090597248 11:128333382-128333404 TTTTATATGCAGTCTCTGTAAGG - Intergenic
1091883955 12:4002695-4002717 CTTTATTTGCTGTGTGTGGTGGG - Intergenic
1093647653 12:21606479-21606501 ATTTATTTGCAATCTGTTCCAGG + Intergenic
1094161444 12:27395055-27395077 AGTTATTTGCAGTCTGAGGTTGG - Intronic
1094866503 12:34538793-34538815 GTTTTTGTGCATTCTGTGGATGG - Intergenic
1096015519 12:48270079-48270101 ATTTTCTTGCAGTCTATGGCTGG + Intergenic
1096597407 12:52705223-52705245 ATTTATTTAGAGACTGTGGGAGG + Intergenic
1097952724 12:65450351-65450373 ATTTATTTGCTATCTGGAGATGG + Intronic
1098276983 12:68822666-68822688 ACTTATTTGCAGTCTGAGTTTGG + Intronic
1099680024 12:85815108-85815130 AATTATTTGCAGTCTTTACAAGG + Intronic
1100346348 12:93735125-93735147 ATTTATTTGCATATTTTGGAGGG - Intronic
1102617231 12:114165304-114165326 ATTTAAATACAGTATGTGGAAGG + Intergenic
1103045794 12:117733514-117733536 ATTTATTTGCACACTGTCTACGG + Intronic
1103155556 12:118681837-118681859 ATTTAATTTCAGTATTTGGAAGG + Intergenic
1103286601 12:119806742-119806764 TTTTATCTGCAGTTTTTGGAGGG - Intronic
1104181919 12:126390110-126390132 GTTTACTTGCAGTCTCTGGGGGG + Intergenic
1104849552 12:131865342-131865364 ATTTATGTGCAGTCCGGGGATGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107613494 13:42140398-42140420 ATCTATTTGGAGTCTGTAAAAGG - Intronic
1108268986 13:48739990-48740012 GCATATGTGCAGTCTGTGGAAGG + Intergenic
1110223893 13:73099552-73099574 AATTATTTGGAGTCTGAGAAAGG + Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1112535776 13:100253951-100253973 ATTTATTAGCAGTGTGAGAATGG - Intronic
1112885627 13:104167703-104167725 ATTCATTTGCAGTGAATGGAAGG + Intergenic
1112931361 13:104742908-104742930 ATTTATTACCAGTATGAGGAAGG + Intergenic
1113297424 13:108975044-108975066 ATTTATTTGCTTTCTATGCAGGG + Intronic
1114963628 14:27928112-27928134 ATTTATTTTCAGATTGTGCATGG + Intergenic
1116149868 14:41127274-41127296 ATTTGTATGCAGCCTGTGTATGG - Intergenic
1116277524 14:42855105-42855127 CTCTATATGCAGTCTCTGGAGGG - Intergenic
1117204816 14:53430574-53430596 ATTTTTTTCCAGTCTGTGGATGG + Intergenic
1117409442 14:55437930-55437952 ATTTATTTTCAGTCCAGGGAAGG + Intronic
1117465287 14:55987360-55987382 ATTTATTAGTAGTGTTTGGATGG + Intergenic
1119281204 14:73409573-73409595 ATATATTTGCAGTTTGAGCAAGG - Intronic
1119683152 14:76607907-76607929 ATCTATCTGCAGTCAGTGGCTGG + Intergenic
1121116876 14:91350021-91350043 ATTAACTGGTAGTCTGTGGAGGG - Intronic
1121386646 14:93533451-93533473 ATGTATTTGCAGTCAGTTGGTGG + Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125106534 15:35978324-35978346 ATTAATTCGGAGTCTATGGATGG + Intergenic
1126087648 15:45024349-45024371 GTCTATTTGCATTCTGTGGAGGG - Intronic
1126606781 15:50485996-50486018 AAGTATTTTCAATCTGTGGATGG + Intronic
1126835321 15:52658050-52658072 ATCTATTTGGAGACAGTGGAGGG - Intronic
1127571519 15:60247667-60247689 ATATATTTAAAGTCTCTGGAAGG - Intergenic
1127826308 15:62707017-62707039 GTTTATTTTCAGGCTGTGAAAGG + Intronic
1127965296 15:63918546-63918568 TTTTATTTGCAGTCTGGGCTGGG + Intronic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1128679404 15:69637040-69637062 ACTTCTTTGCTGTCTTTGGAGGG - Intergenic
1129619299 15:77129214-77129236 ACTTATTTGCTTTCTGGGGAGGG - Intronic
1130745708 15:86651696-86651718 ACTTATTAGCAATCTATGGAGGG - Intronic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1136739428 16:32502414-32502436 GTTTATTTCCATTCTGTGAATGG + Intergenic
1136852817 16:33626864-33626886 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1140599299 16:76456132-76456154 TGTTAATTGCAGTCTTTGGATGG - Intronic
1141015530 16:80445679-80445701 ATTCATTTGCACCCTCTGGACGG + Intergenic
1141614295 16:85201943-85201965 TTTTAGTTGCCATCTGTGGATGG + Intergenic
1203011661 16_KI270728v1_random:297189-297211 GTTTATATCCATTCTGTGGATGG + Intergenic
1203013790 16_KI270728v1_random:329382-329404 GTTTATTTCCATTCTGTGAATGG - Intergenic
1203029996 16_KI270728v1_random:570348-570370 GTTTATATCCATTCTGTGGATGG + Intergenic
1203032125 16_KI270728v1_random:602541-602563 GTTTATTTCCATTCTGTGAATGG - Intergenic
1203039596 16_KI270728v1_random:731890-731912 GTTTATTTCCATTCTGTGAATGG + Intergenic
1203041725 16_KI270728v1_random:764083-764105 GTTTATATCCATTCTGTGGATGG - Intergenic
1144193643 17:12869926-12869948 ATATTTTTCCAGTCTGTGAAGGG + Intronic
1145051087 17:19661554-19661576 AATTATCTGTAGTTTGTGGATGG + Intronic
1149001075 17:51758304-51758326 ATTTATTTGCACACTCTGCAGGG + Intronic
1149785929 17:59434963-59434985 ATTTATTTACAGTATGTCCATGG + Intergenic
1151428679 17:74048201-74048223 ATTTACTTGCAGGCAGTGGCTGG - Intergenic
1151595021 17:75073133-75073155 ATTTATTTTGAGTCTCTGGATGG + Intergenic
1151758389 17:76087547-76087569 AGGTATCTCCAGTCTGTGGAGGG - Intronic
1151897579 17:76990621-76990643 AGTTTTTTGGAGTCTGTGGAGGG + Intergenic
1152035650 17:77870743-77870765 GTTTATTTTCAGTCTGGGTATGG + Intergenic
1152937730 17:83150224-83150246 ATTTCGTGGCAGTCTGTTGAGGG - Intergenic
1153474673 18:5486315-5486337 TTTTATTTGATTTCTGTGGATGG - Intronic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1155564441 18:27118319-27118341 ATTTTCTTCCAGTCTGTGGCTGG + Intronic
1156731759 18:40202619-40202641 ATGTATGTGCATTCTGTGAAGGG + Intergenic
1157266754 18:46230482-46230504 ATTTATTTGTACTCTATGAAGGG + Intronic
1159334938 18:67049926-67049948 ATTTATATGCAGACTGAAGAGGG - Intergenic
1159505946 18:69335829-69335851 ATTTTAATGCAGTCTGTGAAGGG - Intergenic
1160488505 18:79316485-79316507 TATTATTTGCAGTCTTTGGTTGG - Intronic
1164295798 19:23908560-23908582 ATTTATATTAAGTCTTTGGATGG + Intergenic
1165643722 19:37414419-37414441 ATTTATTTGCAATCTGTTTTAGG - Exonic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
925178288 2:1800064-1800086 ATTTATTAGCAGTGTGAGAACGG + Intronic
929379270 2:41331137-41331159 ATTTATTGGAATTTTGTGGATGG + Intergenic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930968711 2:57367086-57367108 ATTTAATTGTAGCCTGTGTAGGG - Intergenic
931119544 2:59200422-59200444 ATTTATTAGCAGTGTGAGAATGG + Intergenic
931170315 2:59796415-59796437 TTTTATTTGTAGTTTGTGGTGGG - Intergenic
931411722 2:62039093-62039115 ATTTATTTCCAGCCTTTGAAGGG + Intronic
931559493 2:63543937-63543959 CTTTATTTGTACTCTGGGGAGGG + Intronic
931674064 2:64676091-64676113 AGTTATTTGCAGTGTGTGACAGG - Intronic
932855630 2:75231376-75231398 ATTTTTTTTCAGTCAGAGGATGG + Intergenic
932998879 2:76895798-76895820 ACTTCCATGCAGTCTGTGGAGGG + Intronic
933564047 2:83927581-83927603 ATTTATTTGCACTATGTGTGAGG + Intergenic
933994317 2:87656648-87656670 ATCTGTCTGGAGTCTGTGGATGG - Intergenic
934621292 2:95809980-95810002 ATTTATTGGCAGATTGTGAAGGG + Intergenic
934727210 2:96630833-96630855 ATAGATTTGCAGGCTATGGAGGG - Intronic
934993630 2:98937893-98937915 CTTTATTTGTATTCTGTGGGTGG + Intergenic
935041127 2:99428222-99428244 AGTTATGTGCAGTATCTGGAGGG - Intronic
935262381 2:101366473-101366495 AAATATTTTCAGTCTGTGGTTGG - Intronic
936299543 2:111294265-111294287 ATCTGTCTGGAGTCTGTGGATGG + Intergenic
936930768 2:117786575-117786597 ATTTATTAGCAGTGTGAGAATGG - Intergenic
937082834 2:119152571-119152593 ATTTATTTTCAGTCTGAAAAAGG + Intergenic
938841246 2:135166300-135166322 TTTTACTTGCAGTCAGTAGAGGG - Intronic
939557033 2:143687464-143687486 ATATATTTGCAGTCTGAAGGAGG - Intronic
942549147 2:177096307-177096329 ATTTATTTGTATACTATGGAAGG - Intergenic
943110867 2:183603912-183603934 ATTTATTTGCAGTCTGTACCTGG + Intergenic
943588239 2:189765514-189765536 TTTTATTAGCAGTTTGTGGTGGG - Intergenic
944303830 2:198156822-198156844 ATTTATTAGCAGTGTGAGAATGG + Intronic
944707406 2:202305074-202305096 ATTTATTTGCTGCCCGTGAAGGG + Intergenic
945730452 2:213525630-213525652 ATTTATTAGCAGTGTGAGAATGG + Intronic
947476479 2:230453014-230453036 TTTTATTAGCAGTGTGAGGATGG - Intronic
947724627 2:232389035-232389057 CTTTATTGGCAGTCTGTGCAGGG - Intergenic
947729857 2:232421657-232421679 CTTTATTGACAGTCTGTGCAGGG - Intergenic
947742211 2:232489808-232489830 CTTTATTGGCAGTCTGTGTGGGG - Intergenic
1171177993 20:23068659-23068681 ATTTTCTTCCAGTCTGTGGCTGG - Intergenic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1175275486 20:57766642-57766664 ATTTACTTTCAGTCTATCGATGG + Intergenic
1176427161 21:6555339-6555361 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1177249877 21:18579036-18579058 ATTCTTTTGCACTCTGTTGAAGG + Intergenic
1178225313 21:30710535-30710557 CTTTATTAGCAGTCTGAGAATGG - Intergenic
1178542464 21:33464907-33464929 ATTTTGTTGCAGTCTGTAGGTGG + Intronic
1179396523 21:41045307-41045329 ATTTATTTGATGTCTTTGGCTGG + Intergenic
1179702652 21:43163657-43163679 ATTTATTTGTAGGCTGGGCACGG + Intergenic
1180713279 22:17854546-17854568 ATGGATTTCCTGTCTGTGGACGG - Intronic
1181516858 22:23419279-23419301 GTTTCTTTGCAGTGTTTGGATGG - Intergenic
1182505964 22:30782654-30782676 ATTTATCTGTTGCCTGTGGATGG + Intronic
1182682423 22:32091156-32091178 ATTTTCTCCCAGTCTGTGGATGG + Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184954000 22:47869767-47869789 ATTTTTTCACAGTCTGTGGCTGG - Intergenic
950214115 3:11146019-11146041 ATTTATGTGCAGTCTTTTGTGGG + Intronic
950408159 3:12817285-12817307 GTTTATGAGCAGGCTGTGGATGG + Exonic
951041775 3:17995891-17995913 ATTTATTTGCTGTCTCTAGATGG + Intronic
951982287 3:28578495-28578517 GTTTCTTTGGAGTCTGAGGATGG + Intergenic
953055043 3:39381320-39381342 ATTTATCTGCAGTCAAGGGAAGG - Intergenic
953237610 3:41120110-41120132 AATTATTTGCAGCCTGTGGGAGG + Intergenic
953488296 3:43324192-43324214 ATTTATTAGCAGCCTGTGGGAGG - Intronic
953617520 3:44504674-44504696 GTTTTCTTCCAGTCTGTGGATGG - Intronic
955842680 3:63128950-63128972 GTAAATTTGCAGTCTATGGATGG - Intergenic
955997793 3:64695286-64695308 ATTTATTTACTGTCTCTGGATGG - Intergenic
957200947 3:77135315-77135337 AGTTATTTGGAGTCTGTGGTGGG + Intronic
960390517 3:117072311-117072333 ATTTAATTGTAGTGTGTGGGAGG - Intronic
960718962 3:120606552-120606574 ATTTAATTTCAGTCTATGGTTGG + Intergenic
964274574 3:154995902-154995924 CTTTATTAGCAGTGTGTGAATGG - Intergenic
964287257 3:155131789-155131811 ATATGTTTGCAGTCTGTTGGAGG + Intronic
965770405 3:172175863-172175885 TTTTGTTTGCACTATGTGGATGG + Intronic
970514484 4:16814417-16814439 ATTCAATTGCAGTCTCTAGATGG - Intronic
971237914 4:24859837-24859859 ATTTTTTTGCAGTTTGTAAAAGG - Intronic
971247958 4:24947487-24947509 CTTTATTTGCAGTGTGAGAACGG + Intronic
971536854 4:27763318-27763340 GTTTATTTGTTGTGTGTGGAAGG - Intergenic
974699899 4:65427937-65427959 ATATATATGTAGTCTGTGGGAGG - Intronic
976369261 4:84268141-84268163 ATCTATTTGCACTGTGTAGAGGG - Intergenic
976386958 4:84471338-84471360 ATTTGTTTTCTATCTGTGGAAGG - Intergenic
976398903 4:84585886-84585908 ATTTATTGGAAGTCTGTACAAGG + Intronic
976992633 4:91386615-91386637 ACTTATTGGCAGTCTGTAGGAGG - Intronic
977352687 4:95908129-95908151 ATTTATTGTAAGTCTGAGGATGG - Intergenic
978234149 4:106437677-106437699 ATTTATTTGTATTTTGTGCATGG + Intergenic
978236334 4:106465463-106465485 ATTCATGTGAAGTCTGTTGAAGG - Intergenic
978832820 4:113110048-113110070 ATTTATTAGCAGTATGAGAACGG - Intronic
979055480 4:115988110-115988132 ATGTATTTGAACTCTGTGTATGG + Intergenic
979058994 4:116030689-116030711 CTTTATTAGCAGTCTGAGAATGG + Intergenic
980929352 4:139170587-139170609 ATTTCTTTACAGTCTGTTGCTGG - Intronic
981836166 4:149056919-149056941 AATTATTTTCATTCTGTAGAAGG - Intergenic
982026818 4:151259465-151259487 CTTTGTTGGCAGTCTGTGGGCGG + Intronic
983303099 4:165952688-165952710 ATGTATTAGTAGTCAGTGGAAGG + Intronic
984407970 4:179357973-179357995 ATTTAGTTGCTGGCTGAGGATGG - Intergenic
984555334 4:181207309-181207331 ATTAATTTGCAGGCTGGTGATGG + Intergenic
988894730 5:35659940-35659962 ATTTATTCTCATTCTGAGGAAGG - Intronic
989294767 5:39811747-39811769 ATTTTCTTTCAGTCTGTGGCTGG + Intergenic
990886900 5:60604861-60604883 ATTTTTTTGGAGTGAGTGGATGG - Intronic
991126264 5:63073044-63073066 ATTTTTTTTCAGTCTTTTGAGGG - Intergenic
993102913 5:83563362-83563384 ATTTGTTTGCAGTCTGGAGGGGG - Intronic
993448376 5:88042993-88043015 AGTTTCTTGCAGCCTGTGGAAGG - Intergenic
995048309 5:107673210-107673232 ATTCATTTCCTCTCTGTGGAAGG - Intergenic
995431700 5:112086588-112086610 ATTTATATGAAGTCTGTAGGAGG - Intergenic
995736567 5:115307286-115307308 ATTTATTTGCAGGCAGTTGAGGG - Intergenic
995739538 5:115340621-115340643 AATTATTTGCAAACTGTGAAAGG + Intergenic
995870096 5:116735425-116735447 AGTTCGTTGCAGTCTGTGTAAGG + Intergenic
996114944 5:119607789-119607811 ATTAAATTGGAGTCTGGGGATGG - Intronic
996374080 5:122785031-122785053 ATGTTTGTGGAGTCTGTGGATGG + Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997681675 5:135760655-135760677 ACTTAGTTTCACTCTGTGGATGG - Intergenic
998272258 5:140717568-140717590 GTTTATATGCAGTGCGTGGAAGG + Intergenic
1000880522 5:166692048-166692070 GTTTATTTCAAGTATGTGGAAGG + Intergenic
1002012759 5:176297094-176297116 ATTTATTGAAAGTTTGTGGATGG + Intronic
1002883327 6:1272080-1272102 AAATATTTTCTGTCTGTGGATGG - Intergenic
1003371954 6:5537279-5537301 ATGTCTGTGCTGTCTGTGGAAGG - Intronic
1003767715 6:9260332-9260354 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1004146145 6:13068498-13068520 TCCTATTTTCAGTCTGTGGATGG + Intronic
1004534707 6:16489391-16489413 ATTTTTTTTGAGTTTGTGGAGGG - Intronic
1005219672 6:23572333-23572355 ATTTATTTTTAGTCTTGGGAGGG - Intergenic
1005339192 6:24827592-24827614 TTTTATTTCCAGTCTCTGAAGGG + Intronic
1007055549 6:38880503-38880525 AGTTCTTTACAGTCTGTGGCTGG - Intronic
1007069328 6:39023839-39023861 ATATATTTGCAGTCTGAGAGTGG - Intronic
1011489601 6:87876891-87876913 ATTTAGTTGCAATCAGTGGGAGG - Intergenic
1011803480 6:91045275-91045297 ATTTTTTTTCAGTGAGTGGATGG + Intergenic
1012559089 6:100556645-100556667 ATATAATTGTAGACTGTGGAGGG + Intronic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1013851591 6:114522424-114522446 GTTTACTTGCTGCCTGTGGAAGG + Intergenic
1016782952 6:147979957-147979979 ATTGATTTTCCTTCTGTGGAAGG + Intergenic
1017872248 6:158496513-158496535 ATTTATTTGCATTATGTACAGGG - Intronic
1022080712 7:27018303-27018325 ATTTTTTTGTATTCTGGGGAAGG - Intergenic
1022394281 7:29971892-29971914 ATTTCTCTGCACTCTGGGGAGGG - Intronic
1023149512 7:37188173-37188195 ATTTATTTGCAGAGTGGTGATGG - Intronic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1025258674 7:57402721-57402743 ATTTATTTGTATTTTTTGGAGGG - Intergenic
1025550996 7:62249366-62249388 GTTTATTTCCATTCTGTGAATGG + Intergenic
1025593428 7:62893579-62893601 ATTTTTTTCCATTCTGTGAATGG + Intergenic
1026378166 7:69773079-69773101 ATTTATTTGAATTTTTTGGAAGG + Intronic
1026414588 7:70165311-70165333 ATTTATTCTGAGTCTGTGGTTGG - Intronic
1027992539 7:85380780-85380802 CTTTTTTTGCATTCTCTGGATGG + Intergenic
1029875718 7:103749437-103749459 ATTTAATTGCAGTTGGTGGTAGG + Exonic
1030490262 7:110223917-110223939 ATTTATTTGCATGCTGTGCAAGG - Intergenic
1030821229 7:114094541-114094563 AATTATTTTCAGTCTGTGGAGGG - Intronic
1030926449 7:115461300-115461322 ATCTATTTGCAGTATTTGGCAGG - Intergenic
1031101336 7:117484107-117484129 ATATTTTTGCAGTTTGTTGAGGG + Intronic
1031190965 7:118550425-118550447 ATTTATTAGCAATCTCTCGAAGG + Intergenic
1032479439 7:132234816-132234838 AACTCTTTGCAGTCTGTGCAAGG - Intronic
1034048697 7:147958888-147958910 ATTTTTTTGCAGTAAGTGTAGGG + Intronic
1034454702 7:151161646-151161668 ATACATTTACAGTCTTTGGAGGG - Intronic
1036944850 8:13085438-13085460 CTTTATTTGCAGTGTGTTGAGGG - Exonic
1038000422 8:23386841-23386863 ATTTATTTGGAGCGTGTGGAGGG - Intronic
1038478276 8:27884210-27884232 TTGTATTTGCAGTCTGTGTGGGG - Intronic
1038775330 8:30525607-30525629 ATTTTTTTGCAGTTTCTGCAAGG + Intronic
1039930193 8:41979619-41979641 ATTTATGTGAAGTCTGAGCAAGG - Intronic
1040320658 8:46296478-46296500 ATTTTTTTACAATCTGTGAAGGG - Intergenic
1040632794 8:49235615-49235637 TTTTATTTGCAGTTTTTTGATGG + Intergenic
1040657003 8:49522095-49522117 AATTATTTGCATGCTGTGGGTGG + Intergenic
1040794927 8:51279158-51279180 ATTTGTTTGCACATTGTGGATGG + Intergenic
1041421620 8:57673038-57673060 GTTTGTTTGCACTTTGTGGATGG + Intergenic
1042446137 8:68887274-68887296 ATTTGTTTAAAGTATGTGGAAGG + Intergenic
1043224799 8:77712443-77712465 CTTTCTTTGAAGTCAGTGGAAGG + Intergenic
1043720057 8:83536672-83536694 TTTTATTTTCAGTCTTTTGATGG + Intergenic
1044867521 8:96586802-96586824 ATTCATTCCCACTCTGTGGAAGG + Intronic
1046651242 8:116838735-116838757 ATTTTTCTGCACTCTGTGGAGGG + Intronic
1046765760 8:118067894-118067916 ATTTATTTTCCCACTGTGGAAGG + Intronic
1047245936 8:123144701-123144723 ATTTATTTGAATTTAGTGGAAGG + Exonic
1047729198 8:127712666-127712688 ATTTATTTGCAGCCACTGGCAGG + Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1050253174 9:3767391-3767413 ATTTGTCTCCAGTCTGTGGGTGG + Intergenic
1050514222 9:6425843-6425865 ATTTCCTTGCTGTCTGTTGAAGG - Intronic
1050690171 9:8218451-8218473 ATTTATGTTTAGTCTGTGAAGGG + Intergenic
1051390962 9:16562584-16562606 TTTTATTAGCAGTATGTAGAAGG - Intronic
1051839790 9:21382293-21382315 ATTTATATGCAGTCGGGGAATGG - Intergenic
1051842228 9:21412078-21412100 ATTTATATGCAGTCAGGGAATGG + Intronic
1052072007 9:24093128-24093150 ATGCATTTGCAGTCAGTTGATGG + Intergenic
1052438691 9:28465105-28465127 TTTGTTTTGCTGTCTGTGGATGG + Intronic
1054878520 9:70121464-70121486 ATTGATTTTCACTCTGTGTATGG + Intronic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1059515731 9:114893307-114893329 ATTTATGTACAGTCTATGGCTGG - Intergenic
1059583966 9:115585146-115585168 CTTTATTTCCAGTCTCTGAATGG - Intergenic
1203432813 Un_GL000195v1:107252-107274 ATTTATTTCCATTCTCTGCAGGG + Intergenic
1185848849 X:3466765-3466787 ATTTTTTTGCCATGTGTGGATGG + Intergenic
1186368904 X:8926522-8926544 ATTGATTTCCACTCTCTGGAGGG - Intergenic
1186941350 X:14511069-14511091 ATTTATTTACACTCTGGGGAGGG - Intergenic
1192780330 X:74287543-74287565 CTTTATTGGAAGTCTGTGCATGG - Intergenic
1193015581 X:76729646-76729668 ATTTATTTGCACACTTTTGAAGG - Intergenic
1193197573 X:78652291-78652313 ATTTATGGTCAGTCTGTAGAAGG - Intergenic
1193248355 X:79257877-79257899 AGCTTTTTACAGTCTGTGGATGG - Intergenic
1194005552 X:88487278-88487300 ATTTGCTTGCATTCTGTAGATGG + Intergenic
1195271881 X:103240211-103240233 ATTTATCTGGAGTCTCTGGTGGG - Intergenic
1195464069 X:105160202-105160224 ATTTCTTTGCAGTCCGTTTACGG + Intronic
1195645393 X:107225686-107225708 TCTTATTTGGAGTCTGGGGAGGG - Intronic
1198619606 X:138491580-138491602 ATTTATTGGATTTCTGTGGAAGG - Intergenic
1201622524 Y:15975999-15976021 AGTTTTTAACAGTCTGTGGAGGG + Intergenic
1202178863 Y:22122287-22122309 AGTTGTTTGCAGTCTGCAGAAGG - Intergenic
1202212498 Y:22464107-22464129 AGTTGTTTGCAGTCTGCAGAAGG + Intergenic