ID: 1133901142

View in Genome Browser
Species Human (GRCh38)
Location 16:9976239-9976261
Sequence CTCACATAGTAGTCATGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 719
Summary {0: 1, 1: 0, 2: 2, 3: 111, 4: 605}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133901142_1133901143 -5 Left 1133901142 16:9976239-9976261 CCATGGCATGACTACTATGTGAG 0: 1
1: 0
2: 2
3: 111
4: 605
Right 1133901143 16:9976257-9976279 GTGAGTCTGTGTTCTTTAACTGG 0: 1
1: 0
2: 4
3: 32
4: 780
1133901142_1133901145 -3 Left 1133901142 16:9976239-9976261 CCATGGCATGACTACTATGTGAG 0: 1
1: 0
2: 2
3: 111
4: 605
Right 1133901145 16:9976259-9976281 GAGTCTGTGTTCTTTAACTGGGG 0: 1
1: 1
2: 7
3: 283
4: 2149
1133901142_1133901144 -4 Left 1133901142 16:9976239-9976261 CCATGGCATGACTACTATGTGAG 0: 1
1: 0
2: 2
3: 111
4: 605
Right 1133901144 16:9976258-9976280 TGAGTCTGTGTTCTTTAACTGGG 0: 1
1: 0
2: 2
3: 51
4: 709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133901142 Original CRISPR CTCACATAGTAGTCATGCCA TGG (reversed) Intronic
901716863 1:11162110-11162132 ATCACGTAGTTCTCATGCCATGG - Intronic
901959953 1:12818433-12818455 GTCACGTAGTTCTCATGCCATGG + Intergenic
905840957 1:41177565-41177587 GTCACGTAGTTCTCATGCCATGG - Intronic
905981613 1:42234214-42234236 GTCACATAGTTCTCATGCCTTGG + Intronic
906361496 1:45163651-45163673 GTCACATAGTTCTCGTGCCATGG - Intronic
906374721 1:45285874-45285896 ATCACGTAGTTCTCATGCCATGG - Intronic
906585868 1:46977302-46977324 ATCACATAGTTCTCGTGCCATGG - Intergenic
907435938 1:54448083-54448105 GTCACGTAGTTCTCATGCCATGG + Intergenic
907994137 1:59611825-59611847 GTCACATAGTTCTCGTGCCATGG - Intronic
908637965 1:66189648-66189670 GTCACGTAGTTCTCATGCCATGG + Intronic
909384700 1:75041121-75041143 GTCACGTAGTTCTCATGCCATGG - Intergenic
909396878 1:75180505-75180527 GTCACGTAGTTCTCATGCCATGG + Intergenic
909449129 1:75778920-75778942 CTCACATAGTTCTCGTGGCATGG - Intronic
910318962 1:85921994-85922016 GTCACGTAGTTCTCATGCCATGG - Intronic
910381603 1:86632775-86632797 ATCACATAGTTCTCGTGCCATGG + Intergenic
910572143 1:88717607-88717629 GTCACGTAGTTCTCATGCCATGG + Intronic
910700624 1:90070265-90070287 CTCACATCAGAGCCATGCCAAGG - Intergenic
910957021 1:92717110-92717132 ATCACGTAGTTCTCATGCCATGG - Intronic
911366762 1:96947939-96947961 GTCAAATAGTAGTGATGACAAGG - Intergenic
911517067 1:98880410-98880432 GTCACATAGTTCTCGTGCCATGG + Intergenic
911676791 1:100667793-100667815 GTCACGTAGTTCTCATGCCATGG + Intergenic
911963520 1:104337154-104337176 ATCAGATAGTTCTCATGCCATGG + Intergenic
912225899 1:107733567-107733589 GTCACGTAGTTCTCATGCCATGG - Intronic
913033242 1:114933730-114933752 ATCACATAGTTCTCATGCCATGG - Intronic
913258442 1:116976049-116976071 GTCACGTAGTTCTCATGCCATGG - Intronic
913473461 1:119214217-119214239 ATCACGTAGTTCTCATGCCATGG + Intergenic
913605095 1:120458306-120458328 ATCACATAGTTCTCGTGCCATGG + Intergenic
913641961 1:120821043-120821065 ATCACATAGTTCTCGTGCCATGG + Intronic
914458850 1:147862959-147862981 ATCACAAAGTTCTCATGCCATGG - Intergenic
914683339 1:149956849-149956871 GTCACATAGTTCTTATGCCATGG + Intronic
914862175 1:151396033-151396055 CTCACATACTAGTGCAGCCATGG + Intergenic
915011635 1:152692214-152692236 GTCACATAGTTCTCATGCCATGG - Intergenic
915586747 1:156847938-156847960 TTCACACTGTAGTCATGCCAGGG + Intronic
915711482 1:157903150-157903172 GTCACGTAGTTCTCATGCCATGG - Intergenic
915757699 1:158278871-158278893 ATCACATAGTTCTCGTGCCATGG + Intergenic
916038268 1:160940691-160940713 GTCACATAGTTCTCGTGCCATGG + Intergenic
916154769 1:161833582-161833604 GTCACATAGTTCTCGTGCCATGG - Intronic
916373467 1:164125763-164125785 ATCACATAGTTCTCGTGCCATGG + Intergenic
916460670 1:165021234-165021256 GTCACATAGTTCTCATGCCTTGG + Intergenic
917175607 1:172231769-172231791 ATCACATAGTTCTCGTGCCATGG - Intronic
917313073 1:173696993-173697015 ATCACATAGTTCTCCTGCCATGG - Intergenic
918593024 1:186261405-186261427 GTCACGTAGTTCTCATGCCATGG + Intergenic
919332751 1:196192389-196192411 ATCACATAGTTCTCATGCCATGG + Intergenic
919603291 1:199648644-199648666 ATCACATAGTTCTCGTGCCATGG - Intergenic
920085525 1:203412788-203412810 ATCACATAGTTCTCATGCCATGG - Intergenic
920373061 1:205491903-205491925 CTCAGAAAGGAGTCAGGCCACGG - Intergenic
920732806 1:208503758-208503780 CTCAAATATTAATCATGCCCGGG - Intergenic
921258037 1:213360372-213360394 GTCACGTAGTTCTCATGCCATGG + Intergenic
921288616 1:213632874-213632896 GTCACGTAGTTCTCATGCCATGG - Intergenic
922383737 1:225060329-225060351 GTCACATAGTTCTCATGCCTTGG + Intronic
922552215 1:226504069-226504091 CTCACGTAGTTCTCCTGCCATGG + Intergenic
922808018 1:228400584-228400606 CTCCCATAGGATTCCTGCCATGG - Intronic
923705130 1:236337747-236337769 CTTACACAGTAATCCTGCCAAGG - Intergenic
924001419 1:239557278-239557300 GCCACATAGTAGTCATGGCAAGG - Intronic
924130249 1:240900100-240900122 GTCACGTAGTTCTCATGCCACGG + Intronic
924169973 1:241328687-241328709 CCCAGATAGTAGCCATGCCTAGG - Intronic
924731496 1:246715510-246715532 GTCACATAGTTCTCATGCCTTGG - Intergenic
1063069377 10:2645632-2645654 ATCAAATAGTAATGATGCCATGG - Intergenic
1065157149 10:22881983-22882005 GTCACAAAGTTGTCGTGCCATGG - Intergenic
1065157696 10:22886958-22886980 ATCACATAGTTCTCCTGCCATGG - Intergenic
1065230572 10:23594600-23594622 GTCACGTAGTTCTCATGCCATGG + Intergenic
1065273960 10:24066958-24066980 GTCACGTAGTTCTCATGCCATGG + Intronic
1065472954 10:26102212-26102234 GTCACATAGTTCTCGTGCCATGG + Intronic
1065594903 10:27300555-27300577 GTCACGTAGTTCTCATGCCATGG - Intergenic
1066077262 10:31891896-31891918 GTCACATAGTTCTCGTGCCATGG + Intronic
1066157997 10:32698530-32698552 ATCACATAGTTCTCGTGCCATGG - Intronic
1066163111 10:32755933-32755955 ATCACATAGTTCTCGTGCCATGG - Intronic
1066173125 10:32873350-32873372 ATCACATAGTTCTCGTGCCATGG + Intronic
1066176584 10:32913495-32913517 ATCACATGGTTCTCATGCCATGG - Intronic
1066701468 10:38134100-38134122 ATCACATAGTTCTCGTGCCATGG + Intergenic
1066751382 10:38660507-38660529 GTCACAAAGTTCTCATGCCATGG - Intergenic
1066806495 10:39260604-39260626 ATCACATAGTTCTCTTGCCATGG - Intergenic
1067172446 10:43919567-43919589 GTCACATAGTTCTCGTGCCATGG + Intergenic
1067807313 10:49401989-49402011 CTCACATAGAATTTATGTCAAGG - Intergenic
1067903233 10:50263706-50263728 ATCACATAGTTCTCGTGCCATGG - Intergenic
1068214793 10:53969184-53969206 CTCAGATAGTTCTCGTGCCATGG - Intronic
1068609408 10:59042661-59042683 GTCACATAGTTCTCATGCCATGG + Intergenic
1069734438 10:70644291-70644313 ATCACAAAGTTCTCATGCCATGG + Intergenic
1070141963 10:73744770-73744792 CTCTGAAAGTAGTCAAGCCATGG - Intronic
1070559685 10:77556770-77556792 CGCACACAATAGTCATTCCATGG + Intronic
1071193850 10:83134272-83134294 GTCACATAGTTCTCGTGCCATGG + Intergenic
1071349778 10:84728455-84728477 GTCACATAGTTCTCATGCCATGG - Intergenic
1071825099 10:89317394-89317416 GTCATATAGTTCTCATGCCATGG - Intronic
1072373725 10:94793169-94793191 ATCACATAGTTCTCATGACATGG + Intronic
1072477490 10:95776948-95776970 GTCACATAGTTCTCATGCCATGG + Intronic
1072961287 10:99931550-99931572 CCCAGATACTTGTCATGCCAGGG + Intronic
1073925080 10:108505705-108505727 ATCACGTAGTACTCGTGCCATGG - Intergenic
1073927501 10:108533864-108533886 ATCACATAGTTCTCGTGCCATGG - Intergenic
1074030791 10:109686381-109686403 ATCACATAGTTCTCGTGCCATGG + Intergenic
1075805238 10:125183772-125183794 GTCACAAAGTTCTCATGCCATGG + Intergenic
1075815663 10:125263085-125263107 CTCACAGGGTTGTCATGTCAGGG + Intergenic
1076216767 10:128701363-128701385 CATGCATAGTAGCCATGCCAGGG + Intergenic
1078032356 11:7765461-7765483 GTCACGTAGTTCTCATGCCATGG - Intergenic
1078166522 11:8890567-8890589 ATCACGTAGTTCTCATGCCATGG - Intronic
1078690122 11:13571151-13571173 GTCACAAAGTTCTCATGCCATGG - Intergenic
1078951816 11:16142677-16142699 GTCACGTAGTTCTCATGCCATGG - Intronic
1078990586 11:16642729-16642751 GTCACATAGTTCTCATGCCATGG + Intronic
1079342428 11:19623580-19623602 GTCACATAGTTCTCATGCCATGG + Intronic
1079683066 11:23322285-23322307 GTCACGTAGTTCTCATGCCATGG - Intergenic
1079873880 11:25832597-25832619 GTCACATAGTTCTCGTGCCATGG - Intergenic
1080001359 11:27354153-27354175 CTTACATATCAGTTATGCCAGGG - Intronic
1080031586 11:27666603-27666625 GTCACATAGTTCTCGTGCCATGG - Intronic
1080150825 11:29050449-29050471 ATCACGTAGTTCTCATGCCAAGG + Intergenic
1080159568 11:29157146-29157168 CTGACAAAGTAGTCATGTCTAGG + Intergenic
1081389825 11:42515958-42515980 GTCACATAGTTCTCATGCCTTGG - Intergenic
1082103062 11:48190560-48190582 ATCACATAGTTCTCATGCCTTGG + Intergenic
1082214214 11:49547538-49547560 GTCACATAGTTCTCATGCCATGG - Intergenic
1082647719 11:55748742-55748764 CTCACGTAGTTCTCGTGCCATGG - Intergenic
1083003557 11:59320282-59320304 TTCACGTAGTCCTCATGCCATGG + Intergenic
1083008705 11:59373376-59373398 ATCACATAGTTCTCGTGCCATGG - Intergenic
1083248743 11:61450991-61451013 CCCACATAGAACTCATTCCAGGG + Intronic
1083494663 11:63041103-63041125 GTCACATAGTTCTCATGCCATGG + Intergenic
1083522921 11:63332946-63332968 GTCACGTAGTTGTCGTGCCATGG + Intronic
1085133332 11:74060952-74060974 ATCACATAGTTCTCGTGCCATGG - Intronic
1085536435 11:77223035-77223057 GTCACGTAGTTCTCATGCCATGG + Intronic
1085966912 11:81539102-81539124 GTCACATAGTTCTCATGCCATGG + Intergenic
1086506175 11:87507056-87507078 ATCACAAAGTTCTCATGCCATGG + Intergenic
1086612749 11:88777251-88777273 ATCACGTAGTTCTCATGCCATGG + Intronic
1086635387 11:89076965-89076987 GTCACATAGTTCTCGTGCCATGG + Intergenic
1086923706 11:92617292-92617314 ATCACGTAGTTCTCATGCCATGG + Intronic
1087100593 11:94360049-94360071 ATCACATAGTTCTCCTGCCATGG - Intergenic
1087249018 11:95875411-95875433 GTCACGTAGTTCTCATGCCACGG + Intronic
1088155401 11:106797090-106797112 ATCACATAGTTCTCGTGCCATGG + Intronic
1088490933 11:110387578-110387600 ATCACATAGTTCTCATGCCATGG + Intergenic
1088656787 11:112007133-112007155 ATCACAAAGTTCTCATGCCATGG - Intronic
1090946893 11:131438596-131438618 GTCACGTAGTTCTCATGCCATGG + Intronic
1091246734 11:134102690-134102712 GTCACGTAGTTCTCATGCCATGG - Intronic
1091326529 11:134693382-134693404 ATCACGTAGTTCTCATGCCATGG - Intergenic
1091925283 12:4342062-4342084 ATCACGTAGTTCTCATGCCATGG - Intronic
1092079116 12:5698772-5698794 GTCACATAGTTCTCGTGCCATGG - Intronic
1092309028 12:7332109-7332131 GTCACATAGTTCTCATGCCGTGG - Intergenic
1092314089 12:7391548-7391570 ATCACAAAGTTCTCATGCCATGG - Intronic
1092517021 12:9225514-9225536 ATCACGTAGTTCTCATGCCATGG + Intergenic
1092638457 12:10477784-10477806 ATCACATAGTTCTCGTGCCATGG + Intergenic
1093717627 12:22401416-22401438 GTCACATAGTTCTCATGCCATGG - Intronic
1094132707 12:27091989-27092011 ATCACATAGTTCTCATGCCATGG - Intergenic
1094135283 12:27119101-27119123 ATCACAAAGTTCTCATGCCATGG + Intergenic
1094587936 12:31795053-31795075 CTCTCATAGAAGTGATACCATGG + Intergenic
1094779501 12:33774178-33774200 GTCACGTAGTTCTCATGCCATGG - Intergenic
1094803575 12:34066292-34066314 GTCACGTAGTTCTCATGCCATGG - Intergenic
1094875774 12:34640844-34640866 ATCACATAGTTCTCATGCCTTGG - Intergenic
1095140676 12:38658226-38658248 ATCACGTAGTTCTCATGCCATGG - Intronic
1095186740 12:39209057-39209079 ATCACATAGTTCTCATGTCATGG - Intergenic
1095191364 12:39261729-39261751 GTCACGTAGTTCTCATGCCATGG - Intergenic
1095798560 12:46247361-46247383 ATCACATAGTTCTCGTGCCATGG - Intronic
1095845386 12:46738308-46738330 TTCACATAGTTCTCGTGCCATGG - Intergenic
1097304394 12:58053125-58053147 ATCACATAGTTCTCTTGCCATGG - Intergenic
1097365056 12:58702636-58702658 ATCACATAGTTCTCGTGCCATGG - Intronic
1097365607 12:58709168-58709190 ATCACATAGTTCTCTTGCCATGG + Intronic
1097724560 12:63059936-63059958 CTAACAGAGTAGTAATGACATGG - Intergenic
1097734487 12:63167066-63167088 GTCACATAGTTCTCGTGCCATGG + Intergenic
1097775116 12:63635613-63635635 GTCACATAGTTCTCATGCCTTGG - Intronic
1098375518 12:69809715-69809737 GTCACGTAGTTCTCATGCCATGG + Intronic
1098699566 12:73607027-73607049 GTCACATAGTTCTCATGCCATGG - Intergenic
1099025592 12:77460589-77460611 GTCACATAGTTCTCGTGCCATGG - Intergenic
1099029198 12:77504235-77504257 CTCACATAGCAGTCACTCAAAGG + Intergenic
1099740488 12:86628072-86628094 GTCACATAGTTCTCCTGCCATGG - Intronic
1100128438 12:91459078-91459100 TTCACATATTATTCATGACATGG + Intergenic
1100563954 12:95776487-95776509 GTCACGTAGTTCTCATGCCACGG - Intronic
1100748769 12:97673908-97673930 GTCACTTAGTTCTCATGCCATGG - Intergenic
1100766075 12:97866871-97866893 GTCACGTAGTTATCATGCCATGG - Intergenic
1101361943 12:104035495-104035517 ATCACATAGTTCTCGTGCCATGG - Intronic
1101401634 12:104393375-104393397 ATCACATAGTTCTCGTGCCATGG + Intergenic
1104086410 12:125478442-125478464 ATCACGTAGTTCTCATGCCACGG - Intronic
1104175255 12:126325467-126325489 ATCACGTAGTTCTCATGCCATGG + Intergenic
1104403401 12:128496648-128496670 GTCACATAGTTCTCGTGCCATGG + Intronic
1105842129 13:24263404-24263426 CTCACTTTATACTCATGCCAAGG + Intronic
1106445645 13:29828491-29828513 GTCACGTAGTTCTCATGCCATGG + Intronic
1107370472 13:39741434-39741456 GTCACATAGTTCTCGTGCCATGG - Intronic
1107393337 13:39990385-39990407 ATCACGTAGTACTCGTGCCATGG + Intergenic
1108553362 13:51568336-51568358 GTCACATAGTTCTCGTGCCATGG - Intergenic
1108713222 13:53054612-53054634 CTCAAACAGATGTCATGCCATGG + Intergenic
1109363368 13:61324903-61324925 ATCACGTAGTACTCGTGCCATGG - Intergenic
1109465706 13:62729011-62729033 GTCACATAGTTCTCGTGCCATGG + Intergenic
1110415319 13:75245979-75246001 GTCACATAGTTCTCGTGCCATGG + Intergenic
1110729844 13:78867187-78867209 ATCACATAGTTCTCGTGCCATGG - Intergenic
1110891484 13:80704005-80704027 GTCACGTAGTTCTCATGCCATGG + Intergenic
1111746906 13:92282073-92282095 GTCACATAGTTCTCGTGCCATGG - Intronic
1112612440 13:100969019-100969041 GTCACGTAGTTCTCATGCCATGG + Intergenic
1112884423 13:104151239-104151261 CTCACATACTTGTCTTGGCATGG + Intergenic
1113021173 13:105889197-105889219 GTCACGTAGTTCTCATGCCATGG + Intergenic
1113300842 13:109017778-109017800 GTCACGTAGTTTTCATGCCATGG + Intronic
1113348658 13:109507096-109507118 GTCACGTAGTTCTCATGCCATGG + Intergenic
1113383711 13:109828188-109828210 ATCACATAGTTCTCATGCCATGG + Intergenic
1113488220 13:110670890-110670912 ATCACATAGTTGTTGTGCCATGG - Intronic
1113590971 13:111500939-111500961 ATCACGTAGTTCTCATGCCATGG + Intergenic
1114581162 14:23761519-23761541 CTCACACACTTCTCATGCCATGG + Intergenic
1114682020 14:24492744-24492766 GTCACATAGTTCTCATGCCATGG - Intergenic
1114923358 14:27362333-27362355 ATCACGTAGTTCTCATGCCATGG + Intergenic
1115391093 14:32855977-32855999 GTCACGTAGTTCTCATGCCATGG + Intergenic
1115799846 14:36980559-36980581 GTCACATAGTTCTCATGCCATGG + Intronic
1115946907 14:38672225-38672247 ATCACATAGTTCTCATGCCATGG - Intergenic
1116067694 14:40005003-40005025 CTCACTCAGTGGTCATGGCAAGG + Intergenic
1116704911 14:48284524-48284546 ATCACGTAGTTCTCATGCCATGG + Intergenic
1116736533 14:48698461-48698483 ATCACGTAGTTCTCATGCCATGG - Intergenic
1117175522 14:53142389-53142411 CTCTCATAGTTTTCATGCTAAGG + Intronic
1118053040 14:62050287-62050309 GTCACATAGTTCTCGTGCCATGG + Intronic
1118067032 14:62203921-62203943 ATCACATAGTTCTCGTGCCATGG + Intergenic
1118146531 14:63143799-63143821 ATCACATAGTTCTCGTGCCATGG + Intergenic
1118484585 14:66201782-66201804 GTCACGTAGTTGTCGTGCCATGG - Intergenic
1118701011 14:68433562-68433584 ATCACGTAGTTCTCATGCCATGG + Intronic
1118829841 14:69420807-69420829 GTCACGTAGTTCTCATGCCATGG + Intronic
1119006979 14:70940939-70940961 ATCACGTAGTTCTCATGCCATGG + Intronic
1122443228 14:101749016-101749038 GTCACGTAGTTCTCATGCCATGG + Intergenic
1123822485 15:24044502-24044524 AACACATAGTTCTCATGCCATGG - Intergenic
1123832666 15:24157106-24157128 GTCACATAGTTCTCATGCCATGG + Intergenic
1123872518 15:24591569-24591591 GACACATAGTAGTAATGTCACGG - Intergenic
1123877496 15:24638747-24638769 GTCACGTAGTTCTCATGCCATGG + Intergenic
1124257756 15:28159547-28159569 GTCACGTAGTTCTCATGCCATGG + Intronic
1125058454 15:35390657-35390679 GTCACGTAGTTCTCATGCCATGG + Intronic
1125501562 15:40242870-40242892 TGCACCTAGTAGTCAGGCCATGG - Intronic
1125779374 15:42251054-42251076 ATCACATAGTTCTCGTGCCATGG + Intronic
1126239604 15:46426236-46426258 GTCACATAGTTCTCTTGCCATGG - Intergenic
1127189477 15:56514734-56514756 ATCACGTAGTTCTCATGCCATGG + Intergenic
1127971069 15:63962157-63962179 GTCACATAGTTCTCGTGCCAGGG + Intronic
1129548691 15:76425431-76425453 GTCACATAGTTCTCGTGCCACGG + Intronic
1130013538 15:80170531-80170553 CTCACATAGTACCCTTGCTAAGG - Intronic
1130476074 15:84268916-84268938 ATCACGTAGTTCTCATGCCAGGG + Intergenic
1130483494 15:84382970-84382992 ATCACGTAGTTCTCATGCCATGG + Intergenic
1130561771 15:84964555-84964577 CTCACATAGTAGCAACTCCAGGG + Intergenic
1130572161 15:85056624-85056646 GTCACATAGTTCTCATGTCATGG + Intronic
1132287822 15:100678379-100678401 GTCACGTAGTTCTCATGCCATGG + Intergenic
1132455550 16:19981-20003 GTCACATAGTTCTCGTGCCATGG + Intergenic
1133901142 16:9976239-9976261 CTCACATAGTAGTCATGCCATGG - Intronic
1134859653 16:17549859-17549881 CTCACATGGTTGTCTTCCCATGG + Intergenic
1135512191 16:23095173-23095195 ATCACAAAGTCCTCATGCCATGG - Intronic
1136652962 16:31688503-31688525 ATCACGTAGTTCTCATGCCATGG - Intergenic
1136679085 16:31944610-31944632 ATCACATAGTGGTCAAGTCAGGG - Intergenic
1136930671 16:34415511-34415533 GTCACACAGTTCTCATGCCATGG + Intergenic
1136973903 16:34996297-34996319 GTCACACAGTTCTCATGCCATGG - Intergenic
1136992024 16:35158693-35158715 GTCACGTAGTTCTCATGCCATGG - Intergenic
1137324866 16:47424243-47424265 ATCACAAAGTTCTCATGCCATGG + Intronic
1137360709 16:47812792-47812814 GTCACGTAGTTCTCATGCCATGG + Intergenic
1137370225 16:47898169-47898191 ATCACGTAGTTCTCATGCCACGG - Intergenic
1137371587 16:47911180-47911202 ATCACATAGTTCTCATGCCATGG - Intergenic
1137808657 16:51331118-51331140 GTCACATAGTTCTCGTGCCATGG - Intergenic
1138722456 16:59097728-59097750 GTCACGTAGTTCTCATGCCATGG - Intergenic
1138782951 16:59810622-59810644 GTCACATAGTTCTCGTGCCATGG - Intergenic
1140054024 16:71510000-71510022 GTCACGTAGTTCTCATGCCATGG + Intronic
1140241350 16:73203810-73203832 CTCAAATGGGAGTCATGCCCAGG - Intergenic
1141235033 16:82208577-82208599 GTCACGTAGTTCTCATGCCATGG + Intergenic
1144448698 17:15355972-15355994 GTCACATAGTTCTCCTGCCATGG - Intergenic
1146562037 17:33878433-33878455 GTCACATAGTTCTCGTGCCATGG - Intronic
1147527648 17:41241210-41241232 GTCACGTAGTTCTCATGCCATGG - Intronic
1149240260 17:54640522-54640544 GTCACATAGTTCTCGTGCCAAGG - Intergenic
1149359416 17:55878121-55878143 GTCACATAGTTATCATACCATGG + Intergenic
1153090464 18:1336525-1336547 ATCACGTAGTTCTCATGCCATGG - Intergenic
1153276344 18:3371637-3371659 ATCACAAAGGAGTCATGCAAAGG + Intergenic
1153419965 18:4893895-4893917 GTCACATAGTTCTCATGCCATGG - Intergenic
1153790812 18:8578036-8578058 GTCACATAGTTCTCGTGCCATGG + Intergenic
1153992104 18:10409789-10409811 GTCAGGTATTAGTCATGCCACGG + Intergenic
1154297345 18:13162329-13162351 CTTAAATAGCAGTGATGCCAGGG - Intergenic
1154320548 18:13347887-13347909 GTCACATAGTTCTCGTGCCATGG + Intronic
1155019986 18:21887761-21887783 ATCACATAGTTCTCGTGCCATGG + Intergenic
1156296071 18:35791922-35791944 GTCACGTAGTTCTCATGCCATGG - Intergenic
1157205636 18:45695775-45695797 GTCACATAGTTCTCATGCCTTGG - Intergenic
1158114348 18:53978536-53978558 ATCACATAGTTCTCATGCCATGG + Intergenic
1158858020 18:61563430-61563452 GTCACATAGTTCTCATGCCATGG + Intergenic
1159629912 18:70737162-70737184 GTCACGTAGTTCTCATGCCATGG - Intergenic
1159810997 18:73017715-73017737 ATCACATAATTCTCATGCCATGG - Intergenic
1162628617 19:11907004-11907026 ATCACATAGTTCTCGTGCCATGG - Intronic
1163881027 19:19922753-19922775 GTCACATAGTTCTCGTGCCATGG + Intronic
1163940837 19:20491627-20491649 ATCACGTAGTTCTCATGCCATGG - Intergenic
1165980506 19:39718758-39718780 GTCACTTAGTTCTCATGCCATGG + Intergenic
1166156326 19:40913993-40914015 ATCACGTAGTTCTCATGCCATGG - Intergenic
926074620 2:9931980-9932002 GTCACATAGTTCTCATGCCATGG + Intronic
926210309 2:10864386-10864408 CCCTCATAGTAGCCAGGCCAGGG + Intergenic
927284016 2:21337240-21337262 GTCACGTAGTTCTCATGCCATGG - Intergenic
927447121 2:23172857-23172879 GTCACGTAGTTCTCATGCCATGG - Intergenic
927502885 2:23593963-23593985 CTCACAGAGAAGACATGGCAGGG - Intronic
928754314 2:34505928-34505950 GTCACATAGTTCTCATGCCATGG - Intergenic
928852653 2:35767761-35767783 GTCACGTAGTTCTCATGCCATGG - Intergenic
929233059 2:39579829-39579851 TTCACATAGTTCTCGTGCCATGG + Intergenic
929319330 2:40522574-40522596 ATCACATAGTAGTGAAGCCTGGG - Intronic
929473751 2:42223612-42223634 CTCACATTGTACTCTTGTCATGG - Intronic
930312288 2:49756273-49756295 CCAACATATTAGTCATTCCAGGG - Intergenic
931043750 2:58326649-58326671 TTCACATAGTTCTCGTGCCATGG - Intergenic
931491564 2:62753808-62753830 GTCACGTAGTTCTCATGCCATGG + Intronic
931530794 2:63211795-63211817 ATCACATAGTTCTCGTGCCATGG - Intronic
931860688 2:66351696-66351718 GTCACGTAGTTCTCATGCCATGG + Intergenic
932007104 2:67938227-67938249 ACCACATAGTAGGCGTGCCAGGG - Intergenic
932399703 2:71471501-71471523 CCCACATAGTAATCATGCCACGG + Intronic
932660400 2:73647018-73647040 ATCACATAGTTCTCATGCCATGG + Intergenic
932662557 2:73669309-73669331 CTCACATAGTTCACGTGCCATGG + Intergenic
933018637 2:77163154-77163176 GTCACATAGTTCTCGTGCCATGG - Intronic
933269168 2:80215072-80215094 ATCACATAGTTCTCGTGCCATGG + Intronic
933594008 2:84263681-84263703 ATCACATAGTTCTCATGCCATGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935256781 2:101316670-101316692 GTCACATAGTTCTCGTGCCATGG - Intergenic
935604612 2:104958423-104958445 ATCACATAGTTCTCGTGCCATGG + Intergenic
935822756 2:106910500-106910522 GTCACATAGTTCTCATGCCATGG - Intergenic
935873563 2:107479605-107479627 CTTACATAGTTGTCATAACAAGG + Intergenic
936857978 2:116982865-116982887 GTCACATAGTTCTCGTGCCATGG - Intergenic
937606065 2:123803361-123803383 GTCACGTAGTTCTCATGCCATGG + Intergenic
937795935 2:126020089-126020111 CTCACATAGTGGTCAGGGCAAGG - Intergenic
938147670 2:128850271-128850293 ATCACGTAGTTCTCATGCCATGG - Intergenic
938718599 2:134044066-134044088 GTCACATAGTTCTCGTGCCATGG - Intergenic
938720305 2:134061581-134061603 GTCACATAGTTCTCATGCCATGG - Intergenic
938799798 2:134751324-134751346 ATCACATAGTTCTCATGCCTTGG + Intergenic
938987915 2:136597363-136597385 GTCACGTAGTTCTCATGCCATGG - Intergenic
939072114 2:137555869-137555891 GTCACGTAGTTCTCATGCCATGG - Intronic
939730954 2:145783698-145783720 GTCACGTAGTTCTCATGCCACGG - Intergenic
939807348 2:146789713-146789735 GTCACATAGTTCTCCTGCCATGG - Intergenic
940602208 2:155876270-155876292 ATCACGTAGTTCTCATGCCATGG - Intergenic
941054165 2:160767797-160767819 ATCACATAGTTCTCATGCCATGG - Intergenic
941553038 2:166940261-166940283 ATCACGTAGTTCTCATGCCATGG + Intronic
941767367 2:169313018-169313040 ATCACGTAGTTCTCATGCCATGG + Intronic
941971330 2:171354774-171354796 GTCACATAGTTCTCGTGCCATGG + Intronic
942107722 2:172649664-172649686 GTCACGTAGTTCTCATGCCATGG - Intergenic
942467378 2:176223066-176223088 ATCACAGAGTTCTCATGCCATGG + Intergenic
943583642 2:189712950-189712972 CTCACATGGTTCTCGTGCCATGG - Intronic
943681867 2:190777063-190777085 GTCACATAGTTCTCGTGCCATGG + Intergenic
943710919 2:191093915-191093937 CTCACATGGTTCCCATGCCATGG - Intronic
943929856 2:193835675-193835697 ATCACATAGTTCTCGTGCCATGG + Intergenic
944520877 2:200565878-200565900 ATCACATAGTTCTCATGCCATGG + Intronic
944629959 2:201613885-201613907 GTCACATAGTTCTCGTGCCATGG - Intronic
945124625 2:206494824-206494846 GTCACATAGTTCTCGTGCCATGG - Intronic
945667279 2:212757959-212757981 GTCACATAGTTCTCGTGCCATGG - Intergenic
945788706 2:214277102-214277124 GTCACGTAGTTCTCATGCCATGG + Intronic
946719176 2:222585697-222585719 GTCACATAGTTCTCTTGCCATGG - Intronic
947436150 2:230074074-230074096 CATACATAGTAGTCATACAATGG + Intergenic
948350109 2:237333339-237333361 CCCCCATAGAAGTCATGCCTGGG + Intronic
1168811587 20:708199-708221 CTCAGAAAGTAGTGGTGCCAGGG - Intergenic
1170186295 20:13594552-13594574 GTCACAAAGTTCTCATGCCATGG - Intronic
1170752724 20:19166467-19166489 GTCACATAGTTCTCCTGCCATGG + Intergenic
1171075240 20:22115935-22115957 ATCACATAGTTCTCGTGCCATGG - Intergenic
1171153806 20:22852718-22852740 ATCACATAGTTCTCATGCCATGG - Intergenic
1171352422 20:24513451-24513473 GTCACATAGTTCTCGTGCCATGG - Intronic
1171434210 20:25106565-25106587 ATCACGTAGTTCTCATGCCATGG - Intergenic
1171443402 20:25185648-25185670 AACACATAGTTCTCATGCCATGG + Intergenic
1173770559 20:45652758-45652780 GTCACATAGTTCTCATGCCTTGG - Intronic
1174694618 20:52544257-52544279 ATCACATAGTTCTCATGCCATGG - Intergenic
1178903691 21:36617845-36617867 GTCACGTAGTTCTCATGCCATGG - Intergenic
1180207205 21:46268416-46268438 CCCACATAGCTGACATGCCAGGG + Intronic
1180323204 22:11342733-11342755 ATCACTTAGTTTTCATGCCATGG - Intergenic
1180640871 22:17298425-17298447 GTCACGTAGTACTCGTGCCATGG + Intergenic
1182157135 22:28084837-28084859 ATCACGTAGTTCTCATGCCATGG - Intronic
1182165135 22:28165004-28165026 ATCACGTAGTTCTCATGCCATGG - Intronic
1182167710 22:28192618-28192640 GTCACGTAGTTCTCATGCCATGG - Intronic
1182169313 22:28210465-28210487 GTCACGTAGTTCTCATGCCATGG - Intronic
1182197157 22:28530236-28530258 GTCACGTAGTTCTCATGCCATGG - Intronic
1182993406 22:34790016-34790038 ATCAGATAGTTCTCATGCCATGG - Intergenic
1185232693 22:49692623-49692645 CTCACATAGAGACCATGCCATGG + Intergenic
949308594 3:2671405-2671427 GTCACATAGTTCTCGTGCCATGG + Intronic
949816774 3:8067435-8067457 ATCACGTAATACTCATGCCATGG + Intergenic
949971866 3:9414183-9414205 GTCACAAAGTAGTTATGCCTAGG + Intronic
950147163 3:10658420-10658442 GTCACATAGTTCTCATGCCATGG - Intronic
950299756 3:11866796-11866818 ATCACAAAGTTCTCATGCCATGG + Intergenic
950597083 3:13994518-13994540 GTCACATAGTTCTCATGCCGTGG + Intronic
951155741 3:19351061-19351083 GTCATATAGTTCTCATGCCATGG - Intronic
951286490 3:20820215-20820237 GTCACATAGTTCTCATGCCATGG + Intergenic
951468974 3:23035215-23035237 CTCACAAAGTTCTCATGCCATGG + Intergenic
951790969 3:26484398-26484420 CTCACATTTTAATCATGACAAGG - Intergenic
953337458 3:42105345-42105367 GTCACATAGTTCTCGTGCCATGG - Intronic
953524852 3:43680262-43680284 GTCACATAGTTCTCGTGCCATGG - Intronic
954500670 3:51011439-51011461 GTCACATAGTTTTCCTGCCATGG + Intronic
954500868 3:51012962-51012984 GTCACATAGTTCTCGTGCCATGG + Intronic
954524240 3:51255677-51255699 ATCACATAGTTCTCATGCCATGG + Intronic
955105295 3:55892003-55892025 CTCACACCGTAATAATGCCATGG - Intronic
955630181 3:60965246-60965268 ATCACGTAGTTCTCATGCCATGG + Intronic
955844753 3:63150590-63150612 CTCACATAGGAGTTTTGTCAAGG - Intergenic
956569696 3:70680488-70680510 GTCACGTAGTTCTCATGCCATGG + Intergenic
956862349 3:73337671-73337693 GTCACATAGTTCTCGTGCCATGG + Intergenic
956926276 3:73992021-73992043 ATCACATAGTTCTCATGCCGTGG - Intergenic
957886830 3:86298345-86298367 GTCACATAGTTCTCGTGCCATGG - Intergenic
958253057 3:91292444-91292466 ATCACGTAGTTCTCATGCCATGG - Intergenic
958624390 3:96606155-96606177 GTCACATAGTTCTCATGCCTTGG + Intergenic
958654497 3:96983868-96983890 ATCACATAGTTCTCATGCCATGG + Intronic
958811039 3:98860050-98860072 GTCACGTAGTTCTCATGCCATGG - Intronic
958849058 3:99301826-99301848 GTCACATAGTTCTCGTGCCATGG - Intergenic
959693042 3:109219907-109219929 GTCACATAGTTCTCGTGCCATGG - Intergenic
960763090 3:121095601-121095623 ATCATATAGTTCTCATGCCATGG + Intronic
960835933 3:121907164-121907186 ATCACATAGTTCTCGTGCCATGG + Intronic
960990232 3:123305363-123305385 GTCACATGGTGGTCATGCTATGG - Intronic
961395980 3:126590777-126590799 GTCACGTAGTTCTCATGCCATGG + Intronic
961901241 3:130213973-130213995 CTCACATAGTAGGAATGAAAGGG - Intergenic
961984712 3:131120793-131120815 GTCACATAGTTCTCGTGCCATGG + Intronic
962657087 3:137558118-137558140 GTCACGTAGTTCTCATGCCATGG - Intergenic
962767090 3:138575279-138575301 GTCACATAGTTCTCGTGCCATGG - Intronic
962907501 3:139818044-139818066 GTCACGTAGTTCTCATGCCATGG + Intergenic
962913971 3:139882265-139882287 ATCACATAGTTCTCGTGCCATGG + Intergenic
963070362 3:141300354-141300376 ATCACATAGTTCTCGTGCCATGG + Intergenic
963159851 3:142140181-142140203 CTCACGAAGTTCTCATGCCATGG + Intronic
963340061 3:144022813-144022835 GTCACATAGTTCTCATGGCATGG + Intronic
963984314 3:151574532-151574554 ATCACATAGTTCTCATGCCATGG + Intergenic
964500340 3:157341351-157341373 GTCATATAGTTCTCATGCCATGG - Intronic
964696150 3:159510283-159510305 ATCACATAGTTCTCGTGCCATGG + Intronic
965311203 3:167130661-167130683 GTCACGTAGTTCTCATGCCATGG - Intergenic
965393163 3:168129612-168129634 GTCACATAGTTTTCATGCCATGG - Intergenic
965886285 3:173450877-173450899 GTCACGTAGTTCTCATGCCATGG + Intronic
965999181 3:174926033-174926055 CTCACATAGTTCTCGTGCCATGG - Intronic
966477691 3:180368681-180368703 ATCACATAGTTCTCATGCCATGG - Intergenic
968055363 3:195687416-195687438 CTCACACAGTAATGATGACAGGG - Intergenic
968055368 3:195687446-195687468 CTCACACAGTAATGATGACAGGG - Intergenic
968100428 3:195961155-195961177 CTCACACAGTATTGATGACAGGG + Intergenic
968100455 3:195961306-195961328 CTCACACAGTAATGATGACAGGG + Intergenic
968100514 3:195961641-195961663 CTCACATAGTAATGATCACAGGG + Intergenic
970643004 4:18088515-18088537 ATCACATAGTAGTCAAGTCTGGG + Intergenic
970983100 4:22124330-22124352 GTCACATAGTTCTCGTGCCATGG - Intergenic
971437371 4:26641755-26641777 ATCACATAGTTCTCGTGCCATGG - Intronic
971441822 4:26695183-26695205 GTCACGTAGTTCTCATGCCATGG - Intronic
971702377 4:29995266-29995288 CTGACATAGTATTCATTCTAAGG + Intergenic
972173705 4:36377807-36377829 ATCACATAGTTCTCGTGCCATGG - Intergenic
972965211 4:44501229-44501251 ATCACGTAGTTCTCATGCCATGG + Intergenic
973883671 4:55298454-55298476 ATCACGTAGTTCTCATGCCATGG - Intergenic
973921630 4:55692149-55692171 ATCACGTAGTTCTCATGCCATGG - Intergenic
974090118 4:57302203-57302225 ATCACGTAGTTCTCATGCCATGG + Intergenic
974119698 4:57624141-57624163 GTCACGTAGTTCTCATGCCATGG + Intergenic
974176787 4:58334647-58334669 ATCACATAGTTCTCATGCCATGG - Intergenic
974371252 4:61019332-61019354 ATCACATAGTTCTCCTGCCATGG - Intergenic
974947345 4:68543758-68543780 ATCACATAGTTCTCGTGCCATGG - Intronic
974966984 4:68773030-68773052 GTCACATAGTTCTCCTGCCATGG + Intergenic
975287344 4:72636158-72636180 ATCACATAGTTCTCATGCCATGG + Intergenic
975305062 4:72840339-72840361 CTCACATAGTTCTTGTGCCATGG + Intergenic
975348507 4:73320712-73320734 ATCACGTAGTTCTCATGCCATGG - Intergenic
975520869 4:75299790-75299812 ATCACGTAGTTCTCATGCCATGG + Intergenic
975821517 4:78276130-78276152 ATCACGTAGTTCTCATGCCATGG + Intronic
976272213 4:83242125-83242147 GTCACGTAGTTCTCATGCCATGG - Intergenic
976289163 4:83399217-83399239 GTCACATAGTTCTCATGCCTTGG - Intergenic
976433328 4:84988540-84988562 ATCACATAGTTCTCGTGCCATGG - Intergenic
976451386 4:85195294-85195316 GTCACGTAGTTCTCATGCCATGG + Intergenic
976974783 4:91153325-91153347 ATCACGTAGTTCTCATGCCATGG + Intronic
977110185 4:92943394-92943416 ATCACATAGTTCTCATGCCATGG + Intronic
977456862 4:97272479-97272501 ATCACGTAGTTCTCATGCCATGG - Intronic
977728673 4:100326095-100326117 CCCACTAAGTAGTCATGCCAAGG + Intergenic
978012874 4:103708832-103708854 GTCACATAGTTCTCGTGCCATGG - Intronic
978110618 4:104960599-104960621 GTCACATAGTTCTCATGCCATGG + Intergenic
978197016 4:105983871-105983893 ATCACATAGTTCTCATGCCAGGG + Intronic
979236405 4:118404997-118405019 ATCACATAGTTCTCGTGCCATGG - Intergenic
979254891 4:118599247-118599269 CTCACATGGAACTCATGCCACGG - Intergenic
979886237 4:126031057-126031079 ATCACATAGTTCTCATGCCTTGG - Intergenic
980090287 4:128436318-128436340 GTCACGTAGTTCTCATGCCATGG + Intergenic
980587074 4:134830975-134830997 GTCATGTAGTACTCATGCCATGG - Intergenic
981459538 4:144996914-144996936 GTCACATAGTTCTCGTGCCATGG - Intronic
982600983 4:157448349-157448371 TTGACACAGTAGTCATGCCTTGG - Intergenic
982792924 4:159614225-159614247 GTCACGTAGTTCTCATGCCATGG + Intergenic
982820042 4:159933887-159933909 GTCACATAGTTCTCATGCCATGG + Intergenic
983292143 4:165820199-165820221 GTCACGTAGTTCTCATGCCATGG - Intergenic
983362525 4:166744813-166744835 ATCACGTAGTTCTCATGCCATGG - Intronic
983486914 4:168343176-168343198 ATCACATAGTTCTCGTGCCATGG + Intergenic
983963944 4:173787219-173787241 GTCACGTAGTTCTCATGCCATGG - Intergenic
986332410 5:6727214-6727236 CTCACACAGCTGGCATGCCATGG + Intronic
987949687 5:24659539-24659561 ATCACTTAGTTCTCATGCCATGG + Intergenic
988187718 5:27888683-27888705 GTCACGTAGTTCTCATGCCATGG + Intergenic
988794996 5:34645491-34645513 ATCACGTAGTTCTCATGCCATGG + Intergenic
988840270 5:35076371-35076393 ATCACATAGTTCTCGTGCCATGG - Intronic
989205899 5:38808971-38808993 CCCACATAGTAGTCCTCCCATGG - Intergenic
989345164 5:40421999-40422021 GTCACGTAGTTCTCATGCCATGG + Intergenic
989614616 5:43327681-43327703 GTCACATAGTTCTCATGCCATGG + Intergenic
989662269 5:43812989-43813011 ATCACATAGTTCTCGTGCCATGG + Intergenic
989670404 5:43910024-43910046 GTCACAAAGTTCTCATGCCATGG - Intergenic
989831619 5:45926564-45926586 GTCACATAGTTCTCATGCCATGG + Intergenic
989843512 5:46111031-46111053 ATCACATAGTTCTCGTGCCATGG + Intergenic
989977172 5:50600933-50600955 GTCACATAGTTCTCATGCCGTGG + Intergenic
990107008 5:52277190-52277212 CTCACATGGCAGTCATGCTGTGG - Intergenic
990188010 5:53228949-53228971 GTCACGTAGTTCTCATGCCATGG + Intergenic
990340185 5:54814274-54814296 GTCACGTAGTTCTCATGCCATGG - Intergenic
990360531 5:55014160-55014182 ATCACATAGTTCTCATGCCATGG - Intronic
991087028 5:62656932-62656954 GTCACGTAGTTCTCATGCCATGG - Intergenic
991089161 5:62677617-62677639 GTCACGTAGTTCTCATGCCATGG + Intergenic
991529811 5:67603140-67603162 ATCACATAGTTCTCGTGCCATGG + Intergenic
992031835 5:72728923-72728945 ATCACATAGTTCTCGTGCCATGG - Intergenic
992301077 5:75380869-75380891 CTCATATAGTAGTAGTTCCAGGG + Intronic
992631286 5:78683264-78683286 GTCACATAGTTCTCGTGCCATGG - Intronic
992873616 5:81029979-81030001 CTCACATAGTTCTCGTGCCATGG - Intronic
992967269 5:82015642-82015664 ATCATATAGTTCTCATGCCATGG + Intronic
993142489 5:84051635-84051657 GTCACGTAGTTCTCATGCCATGG - Intronic
993341515 5:86730648-86730670 ATCACGTAGTTCTCATGCCATGG + Intergenic
993525329 5:88958501-88958523 CTTACACCGTAGTCATGCCATGG + Intergenic
993546735 5:89221235-89221257 ATCACATAGTTCTCGTGCCATGG - Intergenic
993578805 5:89634738-89634760 ATCACGTAGTTCTCATGCCATGG + Intergenic
993610172 5:90044347-90044369 GTCACGTAGTTCTCATGCCATGG + Intergenic
993742376 5:91556697-91556719 GTCACGTAGTTCTCATGCCATGG - Intergenic
994230447 5:97305784-97305806 ATCACGTAGTTCTCATGCCATGG + Intergenic
994387341 5:99147523-99147545 ATCACGTAGTTCTCATGCCATGG - Intergenic
994513999 5:100746637-100746659 GGCACATAGTTGTCATGCTAAGG - Intergenic
994664155 5:102688240-102688262 GTCACATAGTTCTCATGCCGTGG + Intergenic
994861301 5:105199191-105199213 ATCACATAGTTCTCATGCGATGG - Intergenic
995585824 5:113647162-113647184 ATCACAAAGTTTTCATGCCATGG - Intergenic
995665303 5:114535466-114535488 GTCACATAGTTCTCGTGCCATGG + Intergenic
995676874 5:114672058-114672080 CTCACATAGTTCTCAAGCCTTGG - Intergenic
995905344 5:117116606-117116628 GTCACATAGTTGTCGTGCCATGG + Intergenic
996100521 5:119440357-119440379 GTCACAAAGTTCTCATGCCATGG - Intergenic
996159128 5:120140492-120140514 CTCAGATAATGGTCATGACAAGG + Intergenic
996639878 5:125739681-125739703 ATCACATAGTTCTCGTGCCATGG + Intergenic
996935321 5:128942419-128942441 GTCACGTATTTGTCATGCCATGG + Intronic
997020440 5:129994527-129994549 GTCACGTAGTTCTCATGCCATGG + Intronic
997744897 5:136290467-136290489 GTCACATAGTTCTCATGCCGTGG - Intronic
999415694 5:151394218-151394240 ATCACGTAGTTCTCATGCCATGG + Intergenic
999867648 5:155718753-155718775 GTCACATAGTTCTCATGCCATGG + Intergenic
999947123 5:156609860-156609882 ATCACATAGTTCTCGTGCCATGG + Intronic
1000412205 5:160945897-160945919 ATCACATAGTTCTCGTGCCATGG + Intergenic
1000595807 5:163213287-163213309 ATCACATAGTTGTCGTGCCATGG - Intergenic
1001983473 5:176053064-176053086 GTCACGTAGTTCTCATGCCATGG - Intronic
1001986972 5:176082986-176083008 GTCACATAGTTCTCATGCCATGG + Intronic
1002229899 5:177755161-177755183 GTCACATAGTTCTCATGCCATGG - Intronic
1002233995 5:177790988-177791010 GTCACGTAGTTCTCATGCCATGG + Intronic
1002265447 5:178028616-178028638 GTCACATCGTTCTCATGCCATGG + Intronic
1002657385 5:180761484-180761506 ATCACATATTTCTCATGCCATGG + Intergenic
1003228319 6:4226275-4226297 ATCACAAAGTTCTCATGCCATGG - Intergenic
1003496686 6:6669490-6669512 ATCACAAAGTTCTCATGCCATGG - Intergenic
1003985132 6:11427773-11427795 CTCTCCTTGCAGTCATGCCATGG - Intergenic
1004519767 6:16350847-16350869 CTCACATAGTCCTCCTGCCTCGG - Intronic
1004730948 6:18358585-18358607 GTCACGTAGTTCTCATGCCATGG + Intergenic
1006616731 6:35333286-35333308 GTCACGTAGTTCTCATGCCATGG - Intergenic
1007017600 6:38484396-38484418 CTCAAATAGTAGTCAGTCCCAGG - Intronic
1007988252 6:46229584-46229606 ATCACATAGTTCTCTTGCCATGG + Intronic
1008123117 6:47640442-47640464 ATCACGTAGTTCTCATGCCATGG + Intergenic
1008240007 6:49098686-49098708 GTCACATAGTTCTCATGCCATGG - Intergenic
1008281383 6:49599864-49599886 GTCACATAGTTCTCGTGCCATGG - Intergenic
1008339298 6:50345039-50345061 GTCACATAGTTCTCATGCCGTGG - Intergenic
1008398409 6:51036212-51036234 ATCACATAGTTCTCATGCCATGG + Intergenic
1008474485 6:51921742-51921764 ATCACATAGTTCTCATGCCATGG + Intronic
1008529897 6:52447377-52447399 ATCACATAGTTCTCATGCCATGG + Intronic
1008565892 6:52767808-52767830 CTCACATGGCAAACATGCCAAGG - Intergenic
1008570082 6:52808148-52808170 CTCACATGGCAAACATGCCAAGG - Intergenic
1008577547 6:52875550-52875572 CTCACATGGCAAACATGCCAAGG - Intronic
1008779867 6:55090375-55090397 ATCACATAGTTCTCATGCCATGG - Intergenic
1009188462 6:60601141-60601163 ATCACGTAGTTCTCATGCCATGG - Intergenic
1009410885 6:63363526-63363548 ATCACATAGTTCTCATGCCATGG - Intergenic
1010093141 6:72007650-72007672 GTCACGTAGTTCTCATGCCATGG - Intronic
1010102368 6:72124792-72124814 ATCACATAGTTCTCATGCCATGG + Intronic
1010171685 6:72983486-72983508 ATCACATAGTTCTCATGCCATGG + Intronic
1010352209 6:74888091-74888113 GTCACATAGTTCTCATGCCTTGG + Intergenic
1010599216 6:77803287-77803309 GTCACATAGCTCTCATGCCATGG + Intronic
1011012387 6:82716526-82716548 GTCACATAGTTCTCATGCCATGG - Intergenic
1011138998 6:84132658-84132680 ATCACATAGTTCTCGTGCCATGG + Intronic
1011306659 6:85935255-85935277 GTCACATAGTTCTCATACCATGG + Intergenic
1011358411 6:86496923-86496945 ATCACGTAGTTCTCATGCCATGG + Intergenic
1011417875 6:87141007-87141029 ATCACGTAGTTCTCATGCCATGG - Intergenic
1011838811 6:91469778-91469800 GTCACATAGTTCTCATGCCATGG + Intergenic
1012129507 6:95472752-95472774 GTCACGTAGTTCTCATGCCATGG - Intergenic
1012220148 6:96639066-96639088 TTCACATAGTTCTCATGCCTTGG - Intergenic
1012757315 6:103248448-103248470 GTCACATAGTTCTCGTGCCATGG - Intergenic
1013258362 6:108412091-108412113 ATCACATAGTTCTCGTGCCATGG - Intronic
1013387525 6:109646421-109646443 ATCACGTAGTTCTCATGCCATGG - Intronic
1013999084 6:116343963-116343985 ATCACGTAGTTCTCATGCCATGG - Intronic
1014128343 6:117803508-117803530 GTCACATAGTTCTCATGCCATGG + Intergenic
1014423066 6:121268438-121268460 GTCACGTAGTTCTCATGCCATGG - Intronic
1014461749 6:121704246-121704268 GTCACGTAGTTCTCATGCCATGG - Intergenic
1014781531 6:125570690-125570712 CTCATACAGGAGTCATGCCAGGG + Intergenic
1014842771 6:126240023-126240045 GTCACGTAGTTCTCATGCCATGG + Intergenic
1014907240 6:127044574-127044596 ATCACATAGTTCTCATGCCATGG - Intergenic
1015419089 6:132985895-132985917 ATCACGTAGTTCTCATGCCATGG + Intergenic
1016875736 6:148863312-148863334 ATCACGTAGTTCTCATGCCATGG + Intronic
1017303006 6:152883970-152883992 ATCCCATAGTTCTCATGCCATGG - Intergenic
1018011266 6:159671918-159671940 GTCACGTAGTTCTCATGCCATGG - Exonic
1018264543 6:162008442-162008464 CTCACTAAGTACTCAAGCCAAGG + Intronic
1019085466 6:169471550-169471572 ATGACATAGTATTCAAGCCATGG - Intronic
1020785092 7:12563774-12563796 CTCACAAAGTGGTAATGCCAGGG + Intergenic
1020795687 7:12676223-12676245 GTCACATAGTTCTCATGCCATGG - Intergenic
1020928160 7:14358403-14358425 CTCACGTAGTTCTCGTGCCATGG + Intronic
1021201854 7:17736011-17736033 TTCACGTAGTTCTCATGCCATGG - Intergenic
1021342160 7:19478852-19478874 ATCACATAGTTCTCGTGCCATGG + Intergenic
1021375793 7:19905357-19905379 ATCACATAGTTCTCCTGCCATGG + Intergenic
1021431740 7:20567662-20567684 ATCACATAGTTCTCGTGCCATGG - Intergenic
1022135895 7:27448361-27448383 CTCACGAAGTTCTCATGCCACGG + Intergenic
1022453711 7:30538800-30538822 GTCACGTAGTTCTCATGCCATGG - Intronic
1022994791 7:35744011-35744033 GTCACATAGTTCTCGTGCCATGG + Intergenic
1023847752 7:44132265-44132287 GTCACATATTTCTCATGCCAGGG + Intergenic
1024031732 7:45467309-45467331 GTCACGTAGTTCTCATGCCATGG + Intergenic
1024704549 7:51942576-51942598 GTCACATAGTTCTCGTGCCATGG - Intergenic
1025034101 7:55582003-55582025 GTCACATAGTTCTCGTGCCATGG + Intergenic
1025601048 7:62998022-62998044 GTCACTTAGTTTTCATGCCATGG + Intergenic
1025640722 7:63365726-63365748 GTCACATAGTTCTCGTGCCATGG + Intergenic
1025737281 7:64161832-64161854 GTCACATAGTTCTCATGCCATGG - Intronic
1027330631 7:77089355-77089377 GTCACATAGTTCTCATGCCTTGG + Intergenic
1027447330 7:78289283-78289305 ATCACATAGTTCTCATGCCATGG - Intronic
1028395399 7:90363950-90363972 GTCACATAGTTCTCATGCCATGG + Intronic
1028578608 7:92381083-92381105 GTCACATAGTTCTCGTGCCATGG - Intronic
1028691936 7:93662835-93662857 ATCACATAGTTCTCGTGCCATGG + Intronic
1028836539 7:95380528-95380550 ATCACGTAGTTCTCATGCCATGG - Intronic
1029325305 7:99802434-99802456 GTCACATAGTTCTCGTGCCATGG + Intergenic
1029780213 7:102723867-102723889 ATCACGTAGTTCTCATGCCATGG - Intergenic
1029785133 7:102781981-102782003 GTCACATAGTTCTCATGCCTTGG - Intronic
1030142733 7:106321451-106321473 GTCACGTAGTTCTCATGCCATGG - Intergenic
1031435122 7:121724152-121724174 ATCACGTAGTTCTCATGCCATGG + Intergenic
1031527179 7:122835610-122835632 ATCACGTAGTTCTCATGCCATGG - Intronic
1031664451 7:124467553-124467575 GTCACATAGTCCTCGTGCCATGG + Intergenic
1031842898 7:126768041-126768063 CTCACATGGTATTCATGGCCTGG + Intronic
1033102797 7:138490166-138490188 ATCACCTAGTTCTCATGCCATGG + Intronic
1033902380 7:146158569-146158591 GTCACATAGTTCTCATGCCGTGG - Intronic
1034360959 7:150497432-150497454 ATCACGTAGTTCTCATGCCATGG - Intergenic
1037041520 8:14241789-14241811 CACACATATTCTTCATGCCAAGG + Intronic
1037398457 8:18468215-18468237 GTCACATAGTTCTCATGCCATGG - Intergenic
1037545320 8:19914808-19914830 ATCACGTAGTTCTCATGCCATGG + Intronic
1038366345 8:26939753-26939775 ATCACGTAGTTCTCATGCCATGG + Intergenic
1038655847 8:29450515-29450537 GTCACGTAGTTCTCATGCCATGG - Intergenic
1039146224 8:34450555-34450577 CTCACATAGTTCTTGTGCCATGG + Intergenic
1039624207 8:39031462-39031484 GTCACATAGTTCTCGTGCCATGG + Intronic
1039719065 8:40143012-40143034 GTCACATAGTTCTCATGCCATGG + Intergenic
1040428238 8:47311006-47311028 CTAACATAGGAGTCATATCAAGG - Intronic
1040451603 8:47553559-47553581 ATCACGTAGTTCTCATGCCATGG + Intronic
1040473177 8:47753287-47753309 ATCACATAGTTCTCATGCCATGG - Intergenic
1040608428 8:48958704-48958726 ATCACATAGTTCTCGTGCCATGG + Intergenic
1040612491 8:48998921-48998943 CTCACATAGTTCTCATGCCATGG - Intergenic
1041302815 8:56430409-56430431 ATCACGTAGTTCTCATGCCATGG - Intergenic
1041387589 8:57320423-57320445 ATCACATAGTTCTCTTGCCATGG - Intergenic
1041388080 8:57325743-57325765 GTCACGTAGTTCTCATGCCATGG + Intergenic
1043048648 8:75358657-75358679 GTCACGTAGTTCTCATGCCATGG + Intergenic
1043831669 8:84996727-84996749 ATCACATAGTTCTCGTGCCATGG + Intergenic
1043911798 8:85873090-85873112 GTCACATAGTTCTCGTGCCATGG + Intergenic
1044042418 8:87386440-87386462 GTCACATAGTTCTCGTGCCACGG - Intronic
1044203075 8:89458842-89458864 ATCACGTAGTTCTCATGCCATGG - Intergenic
1044272697 8:90265424-90265446 GTCACATAGTTCTCATGCCCTGG - Intergenic
1044449057 8:92312963-92312985 ATCACGTAGTTCTCATGCCATGG + Intergenic
1045123541 8:99064434-99064456 TTCACATAGTTCTCATGCCATGG - Intronic
1045280795 8:100747906-100747928 CTCACCAAGTAGTCATCTCATGG - Intergenic
1045405488 8:101862777-101862799 GTCACATAGCACTCATCCCAGGG - Intronic
1045788828 8:105956976-105956998 GTCACATAGTTCTCGTGCCATGG - Intergenic
1046225243 8:111270047-111270069 CTCACATGATAATCATGGCATGG + Intergenic
1046683023 8:117192742-117192764 GTCACATAGTTCTCGTGCCATGG - Intergenic
1047931672 8:129734002-129734024 ATCACGTAGTTCTCATGCCATGG - Intergenic
1048858571 8:138704957-138704979 ATCACGTAGTTCTCATGCCATGG - Intronic
1049484962 8:142851265-142851287 ATCACATAGTTCTCTTGCCATGG - Intronic
1049819890 8:144627100-144627122 CTCACAAAGGAGCCAGGCCAAGG + Intergenic
1050068215 9:1783285-1783307 GTCACATAGTTCTCATGCCTTGG + Intergenic
1050215098 9:3313699-3313721 TTCACGTAGTTCTCATGCCATGG - Intronic
1050497815 9:6263122-6263144 GTCACATAGTTCTCGTGCCATGG + Intergenic
1050787826 9:9427239-9427261 GTCACGTAGTTCTCATGCCATGG - Intronic
1051145861 9:14026715-14026737 CTCAAATACTAGTTGTGCCATGG + Intergenic
1051238494 9:15026512-15026534 ATCACAAAGTTCTCATGCCATGG - Intergenic
1051296284 9:15599963-15599985 GTCACATAGTTCTCTTGCCATGG + Intronic
1052145587 9:25044781-25044803 ATCACGTAGTTCTCATGCCATGG + Intergenic
1052640376 9:31159763-31159785 ATCACATAGTTCTCATGCCATGG + Intergenic
1052724777 9:32216646-32216668 GTCACATAGTTCTCATGCCGTGG + Intergenic
1053583046 9:39426608-39426630 ATCACATAGTTCTCATGTCATGG - Intergenic
1053847231 9:42251469-42251491 ATCACATAGTTCTCATGTCATGG - Intergenic
1054104627 9:60985351-60985373 ATCACATAGTTCTCATGTCATGG - Intergenic
1054887147 9:70211441-70211463 ATCACATAGTTCTCTTGCCATGG + Intronic
1055820516 9:80256409-80256431 CTCATATAGTACTCATGGGAGGG - Intergenic
1056668196 9:88598645-88598667 GTCACGTAGTTCTCATGCCATGG - Intergenic
1056997027 9:91472519-91472541 GTCACGTAGTTCTCATGCCATGG + Intergenic
1057342821 9:94218058-94218080 ATCACATAGTTCTCCTGCCATGG - Intergenic
1057768961 9:97950168-97950190 ATCACGTAGTTCTCATGCCATGG + Intergenic
1058012125 9:99989850-99989872 GTCACATAGTTCTCGTGCCATGG - Intronic
1058202873 9:102065992-102066014 GTCACAAAGTTTTCATGCCATGG + Intergenic
1058750076 9:108031400-108031422 GTCACATAGTTCTCATACCATGG + Intergenic
1060038096 9:120275967-120275989 ATCACAAAGTTCTCATGCCATGG + Intergenic
1060675360 9:125509628-125509650 CTCTCAGAGTACACATGCCAGGG - Intronic
1060870222 9:127034052-127034074 CCCACATAGTTGTGATGCCAGGG - Intronic
1203370881 Un_KI270442v1:303303-303325 ATCACTTAGTTTTCATGCCATGG - Intergenic
1186563680 X:10639340-10639362 ATCACGTAGTTCTCATGCCATGG - Intronic
1186775718 X:12863110-12863132 ATCACATAGTTCTCGTGCCATGG + Intergenic
1188238787 X:27759868-27759890 ATCACATAGTTCTCGTGCCATGG - Intergenic
1191028148 X:55937700-55937722 ATCACGTAGTTCTCATGCCATGG - Intergenic
1191138227 X:57089815-57089837 ATCACATAGTTCTCATGCCATGG + Intergenic
1191203480 X:57809836-57809858 ATCACGTAGTTCTCATGCCATGG + Intergenic
1191647100 X:63493418-63493440 GTCACATAGTTCTCGTGCCATGG - Intergenic
1191744942 X:64476765-64476787 GTCACAAAGTCCTCATGCCATGG + Intergenic
1191757177 X:64606278-64606300 CTCACAAAGTTCTCATGCCATGG + Intergenic
1191775624 X:64809700-64809722 ATCACATAGTTCTCATGCCATGG - Intergenic
1191782129 X:64880005-64880027 GTCACATAGTTCTCATGCCATGG - Intergenic
1191969062 X:66793851-66793873 ATCACGTAGTTCTCATGCCATGG + Intergenic
1192371729 X:70519930-70519952 GTCACGTAGTTCTCATGCCATGG + Intergenic
1192525755 X:71842740-71842762 GTCACATAGTTCTCATGCCTTGG + Intergenic
1192666971 X:73098750-73098772 CTCACGTAGTTCTCATGCCATGG + Intergenic
1192674998 X:73186157-73186179 ATCACGTAGTTCTCATGCCATGG - Intergenic
1192685835 X:73304447-73304469 GTCACACAGTTCTCATGCCATGG + Intergenic
1192697508 X:73433444-73433466 GTCACATAGTTCTCATGCCATGG + Intergenic
1192871689 X:75190793-75190815 ATCACATAGTTCTCATGCCATGG + Intergenic
1192954191 X:76051610-76051632 ATCACATAGTTCTCATGCCTTGG + Intergenic
1192973662 X:76260335-76260357 CTCACAAAGTTCCCATGCCATGG + Intergenic
1193000900 X:76560860-76560882 ATCACATAGTTCTCATGCCATGG - Intergenic
1193072449 X:77320193-77320215 GTCACGTAGTTCTCATGCCATGG - Intergenic
1193146438 X:78081177-78081199 CTCACGTAGTTCTCATGCCATGG + Intronic
1193156209 X:78176772-78176794 ATCACATAGTTCTCGTGCCATGG - Intergenic
1193189259 X:78549978-78550000 GTCACATAGTTCTCCTGCCATGG - Intergenic
1193315938 X:80065353-80065375 GTCACATAGTTCTCATGCCATGG + Intergenic
1193376531 X:80767906-80767928 GTCACGTAGTTCTCATGCCATGG - Intronic
1193452259 X:81685251-81685273 GTCACATAGTTCTCATGCCATGG - Intergenic
1193582619 X:83284652-83284674 ATCACGTAGTTCTCATGCCATGG + Intergenic
1193592618 X:83408390-83408412 ATCACATACTTTTCATGCCATGG - Intergenic
1193641098 X:84010153-84010175 ATCACATAGTTCTCATGCCATGG - Intergenic
1194094377 X:89619359-89619381 ATCACATAGTTCTCGTGCCACGG + Intergenic
1194342025 X:92716885-92716907 GTCACATAGTTCTCATGCCATGG - Intergenic
1194727045 X:97410731-97410753 ATCACGTAGTTCTCATGCCATGG - Intronic
1194776519 X:97971953-97971975 CTAACATAAAAGTCATTCCAAGG - Intergenic
1195163567 X:102195870-102195892 GTCACATAGTTCTCATGCCATGG + Intergenic
1195214985 X:102690696-102690718 GTCACATAGTTCTCATGCCTTGG + Intergenic
1195391294 X:104365457-104365479 GTCACGTAGTTCTCATGCCACGG + Intergenic
1195572145 X:106408338-106408360 GTCACGTAGTTCTCATGCCATGG - Intergenic
1195723453 X:107889933-107889955 ATCACATAGTTCTCGTGCCATGG + Intronic
1195733585 X:107990886-107990908 ATCACATAGTTCTCATGCCATGG + Intergenic
1195832165 X:109071440-109071462 ATCACATAGTTCTCGTGCCATGG + Intergenic
1196012399 X:110903177-110903199 TTCACAAAGTTCTCATGCCATGG + Intergenic
1196139478 X:112245510-112245532 GTCACGTAGTTCTCATGCCATGG + Intergenic
1197543084 X:127790091-127790113 GTCACATAGTTCTCGTGCCATGG - Intergenic
1198168495 X:134080782-134080804 ATCACATAGTTCTCGTGCCATGG - Intergenic
1198365981 X:135940575-135940597 GTCACGTAGTTCTCATGCCATGG + Intergenic
1198489431 X:137123734-137123756 GTCACGTAGTTCTCATGCCATGG - Intergenic
1198595593 X:138232042-138232064 GTCACGTAGTTCTCATGCCATGG - Intergenic
1198712927 X:139524861-139524883 ATCACATAGTTCTCGTGCCATGG - Intergenic
1199098204 X:143767062-143767084 GTCACATAGTTCTCGTGCCATGG + Intergenic
1199302792 X:146232750-146232772 ATCACCTAGTTCTCATGCCATGG + Intergenic
1199450036 X:147968752-147968774 GTCACGTAGTTCTCATGCCATGG - Intergenic
1199484124 X:148330276-148330298 GTCACATAGATCTCATGCCATGG + Intergenic
1199911710 X:152294441-152294463 GTCACATAGTTCTCGTGCCATGG + Intronic
1200288412 X:154847599-154847621 GTCACATAGTTCTCGTGCCATGG + Intronic
1200400823 X:156019748-156019770 GTCACATAGTTCTCGTGCCATGG - Intergenic
1200447011 Y:3275538-3275560 ATCACATAGTTCTCGTGCCACGG + Intergenic
1200689564 Y:6293574-6293596 GTCACATAGTTCTCATGCCATGG + Intergenic
1200879236 Y:8194778-8194800 ATCACATAGTTCTCGTGCCACGG - Intergenic
1201045708 Y:9881146-9881168 GTCACATAGTTCTCATGCCATGG - Intergenic
1201347975 Y:13005540-13005562 ATCACGTAGTTCTCATGCCATGG - Intergenic
1201533094 Y:15013985-15014007 ATCACGTAGTTCTCATGCCATGG - Intergenic
1201776055 Y:17667375-17667397 ATCACATAGTTCTCGTGCCATGG + Intergenic
1201825501 Y:18238617-18238639 ATCACATAGTTCTCGTGCCATGG - Intergenic
1201920791 Y:19231633-19231655 ATCACATAGTTCTCATGCCATGG + Intergenic
1201945793 Y:19508835-19508857 ATCACATAGTTCTCATGCCATGG + Intergenic
1201952892 Y:19585272-19585294 ATCACATATTTCTCATGCCATGG + Intergenic
1201971574 Y:19802896-19802918 GTCACATAGTTCTCATGCCATGG - Intergenic
1202026538 Y:20529511-20529533 GTCACGTAGTTCTCATGCCATGG - Intergenic
1202034619 Y:20619646-20619668 ATCACGTAGTTTTCATGCCATGG + Intergenic
1202055152 Y:20822019-20822041 GTCACATAGTTCTCATGCCATGG + Intergenic
1202253846 Y:22900812-22900834 ATCACATAGTTTTCATGTCATGG + Intergenic
1202406836 Y:24534561-24534583 ATCACATAGTTTTCATGTCATGG + Intergenic
1202463945 Y:25135520-25135542 ATCACATAGTTTTCATGTCATGG - Intergenic