ID: 1133902155

View in Genome Browser
Species Human (GRCh38)
Location 16:9986963-9986985
Sequence GTGGTGCTGGAAGGAAACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133902155_1133902162 8 Left 1133902155 16:9986963-9986985 CCCGAGTTTCCTTCCAGCACCAC 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1133902162 16:9986994-9987016 AATCTCTGGATATGGTACCCAGG 0: 1
1: 1
2: 2
3: 29
4: 252
1133902155_1133902159 -6 Left 1133902155 16:9986963-9986985 CCCGAGTTTCCTTCCAGCACCAC 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1133902159 16:9986980-9987002 CACCACTGAATCAGAATCTCTGG 0: 1
1: 2
2: 34
3: 224
4: 938
1133902155_1133902161 0 Left 1133902155 16:9986963-9986985 CCCGAGTTTCCTTCCAGCACCAC 0: 1
1: 0
2: 1
3: 25
4: 271
Right 1133902161 16:9986986-9987008 TGAATCAGAATCTCTGGATATGG 0: 3
1: 5
2: 69
3: 417
4: 1278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133902155 Original CRISPR GTGGTGCTGGAAGGAAACTC GGG (reversed) Intronic
900543409 1:3215505-3215527 GTGGTGCAGGAAGGAAGGTGGGG + Intronic
900659375 1:3775048-3775070 AGTGTGCTGGAAGGAAACACTGG + Intronic
902041478 1:13495659-13495681 GTGGTGCTGCAAGGAGCATCAGG - Intronic
903480753 1:23651597-23651619 ATGGGGCTGGACAGAAACTCAGG + Intergenic
903542209 1:24102916-24102938 CTGGGGCTGGACGGAACCTCTGG + Intronic
904792057 1:33030091-33030113 GTGGTGCAGGACGTAAACACAGG - Intronic
905142168 1:35856105-35856127 GTGGTGGTGGAAGAAAAGCCGGG + Exonic
907430434 1:54408010-54408032 TTGGTTCAGGAAGGAGACTCTGG + Intronic
908101693 1:60797592-60797614 ATGGAGCTGGAAACAAACTCAGG + Intergenic
908236487 1:62152090-62152112 GTGGTGCTTGTCAGAAACTCAGG - Intronic
911101993 1:94102532-94102554 TGGGTGCTGCAAGGAAAATCCGG - Intronic
912466289 1:109877228-109877250 GTGGAGCTGGAAGGAAGCTGGGG - Intergenic
912826260 1:112906269-112906291 GTTGTGCTGGATGGAAGCTTTGG - Intergenic
912877203 1:113371872-113371894 GTGCTGCTGGAAGGACAAGCTGG + Intergenic
913200358 1:116491094-116491116 ATGGGGCTGGAAGGAAAGGCAGG - Intergenic
915904678 1:159869130-159869152 GTGATGGTGGAAGGAGACGCTGG - Intronic
916977426 1:170096004-170096026 CCTGTCCTGGAAGGAAACTCTGG + Intergenic
917838152 1:178957084-178957106 GTGGAGGTGGCAGGAAACCCAGG + Intergenic
918223848 1:182460658-182460680 GTGGTGCTGGAGGGACTCCCAGG + Intronic
918270527 1:182893880-182893902 GTGGTGGTGGTAGGAAAGTGGGG + Intergenic
919979526 1:202633648-202633670 GGAGAGCTGGAAGGAAACTTAGG + Intronic
920419979 1:205826457-205826479 GTGGGGCTGGAAAGAAATGCTGG + Intergenic
920809206 1:209266308-209266330 TTGGTGTTAGAAGGAACCTCAGG + Intergenic
922507086 1:226132896-226132918 GTGGAACTGGAAGGAGACCCGGG - Intergenic
922750311 1:228067153-228067175 GTGCTGTTGGAAGGAGACCCAGG - Intergenic
923019667 1:230153624-230153646 GTGGGGCTGGAAGGGTACTTAGG - Intronic
923678398 1:236099808-236099830 GTGGATCTGGAAGGCAACTCGGG + Intergenic
1063349753 10:5343338-5343360 TTGCTGGTGGAAGTAAACTCGGG + Intergenic
1064071188 10:12229389-12229411 ATGGAGCTGGACAGAAACTCTGG - Intronic
1065196039 10:23266359-23266381 GTGGTGCTGGGTGGAGACTTGGG + Intergenic
1066441158 10:35440277-35440299 GTGAGGCAGAAAGGAAACTCAGG + Intronic
1066959452 10:42207266-42207288 CTGGTTCAGGAAGGAAATTCGGG + Intergenic
1067160423 10:43820925-43820947 GGGGTGCTGAAAGGAGGCTCGGG - Intergenic
1067437604 10:46289004-46289026 ATGGTGCTGAATTGAAACTCTGG + Intronic
1068588461 10:58827820-58827842 GTGGTGGTGGAAGGAGAGGCAGG - Intronic
1069123598 10:64600937-64600959 ATGTTGCTGGAAGCAAATTCAGG - Intergenic
1069870512 10:71529987-71530009 CTGGGGCTGGATGGAGACTCAGG + Intronic
1069870958 10:71532588-71532610 CTGGGGCTGGATGGAGACTCAGG + Intronic
1070558500 10:77548153-77548175 GTGGATTTGGAAGGAAACTCAGG - Intronic
1070609365 10:77922962-77922984 CTGGAACTGGAAGGAAACTGGGG - Intronic
1070780401 10:79134237-79134259 GTGGAGCTGGGAGGAACCTGTGG + Intronic
1071899970 10:90109731-90109753 TTGGTGCTGGAAGAAAAATGAGG + Intergenic
1072516955 10:96194112-96194134 GTTGTCCTGCTAGGAAACTCTGG - Intronic
1076319184 10:129565718-129565740 GTGGTGATGGAAGAAGACCCTGG + Intronic
1076494077 10:130885436-130885458 GGGGTGGGGGCAGGAAACTCAGG + Intergenic
1077176459 11:1193347-1193369 GTGGGGCAGGAAGGAAACTGGGG + Intronic
1077521458 11:3037808-3037830 GTGCCACTGGAAGGAGACTCGGG - Intronic
1078895677 11:15594886-15594908 CTGGGGCTGGCAGGAAGCTCGGG - Intergenic
1081741684 11:45445330-45445352 GTGATGCTGGAAGCCACCTCTGG + Intergenic
1082057878 11:47834867-47834889 TTGGTGCAGGATGGAAACTCAGG + Intronic
1083489288 11:63003343-63003365 ATGGTGGTGGATGGAATCTCCGG + Intronic
1083707337 11:64525585-64525607 GAGGGGCTGGAAGGAATCACAGG - Intergenic
1083923726 11:65793731-65793753 GTGGGGCAGGCAGAAAACTCCGG + Intronic
1084675703 11:70632804-70632826 GTTGATCTGGAAGGTAACTCGGG + Intronic
1086719403 11:90101487-90101509 GTGGTCCGGGCAGGAAATTCAGG - Intergenic
1086846443 11:91755573-91755595 GTGATGCTGGAGGGAAAGACAGG - Intergenic
1086981134 11:93198425-93198447 GTGGTGCTGAAAGAAAATTAAGG + Intergenic
1087399153 11:97642818-97642840 AAGGTGGTGGAAGGAAACTTTGG + Intergenic
1088330653 11:108647720-108647742 GTGGAGCTGGACGGGAACTCAGG - Intergenic
1088749296 11:112830495-112830517 GTGGTTGTGGAAGGACACTTGGG - Intergenic
1089118733 11:116117097-116117119 GTGGTTCTTCAAGGAAACTTGGG + Intergenic
1089461405 11:118656335-118656357 GTTTTGCTGAGAGGAAACTCTGG + Intronic
1090183095 11:124718156-124718178 GAGGTGCTGGAAGGCCCCTCCGG - Intergenic
1091108658 11:132944670-132944692 GTGGTGCTGGGAGGTGACTGGGG + Intronic
1091123088 11:133073214-133073236 CTGGTGCCTGAAGGAAACTTGGG - Intronic
1094369682 12:29724488-29724510 GTGGTGATGGAAAGAAATTTGGG - Intronic
1096157699 12:49349791-49349813 CAGGTGCTGGAAGGATATTCTGG + Intronic
1098260373 12:68664066-68664088 GTGGGTCTGTAAGGAAAGTCAGG - Exonic
1098581211 12:72101505-72101527 TTGGTTCTGGAAGGAAATTGAGG + Intronic
1100136478 12:91558663-91558685 GTGTGGCTGATAGGAAACTCTGG - Intergenic
1103799968 12:123531943-123531965 TAGGGGCAGGAAGGAAACTCAGG - Intronic
1103999050 12:124848650-124848672 GTGGTGGTGGAAGAACACACTGG + Intronic
1104586540 12:130052529-130052551 CTGGTGCTTGAAGGAAGCTCAGG + Intergenic
1106105630 13:26730602-26730624 GGGGTGCTGGAAGGAAGGTGAGG - Intergenic
1107195415 13:37645276-37645298 CTGCTGCTGCAAGGAAACTCCGG + Intronic
1109019092 13:57061942-57061964 CCAGTGCTGGAAGGAAAATCAGG - Intergenic
1110216863 13:73033381-73033403 GTGGTGCTGGAATGTAAAACTGG - Intergenic
1112435769 13:99390291-99390313 GTGGGTTTGGAAGAAAACTCTGG - Intergenic
1113595785 13:111530778-111530800 GTGGTGCTGAAGGGAAACCTGGG - Intergenic
1114051699 14:18924177-18924199 GTAGAGCAGGAATGAAACTCAGG + Intergenic
1114110860 14:19477748-19477770 GTAGAGCAGGAATGAAACTCAGG - Intergenic
1115186831 14:30698519-30698541 AAGATGCTGGAAGCAAACTCGGG + Intronic
1115408474 14:33046335-33046357 GTGGTTCTGGAAGAATCCTCAGG + Intronic
1115852701 14:37600014-37600036 GTGCTGCTGAAAGGATCCTCGGG + Intronic
1115879598 14:37899989-37900011 TGGAGGCTGGAAGGAAACTCTGG - Intronic
1116460191 14:45163756-45163778 GTGGTGCTAAAAGTAAACTCTGG + Intronic
1117556105 14:56885909-56885931 GGTGGGCTTGAAGGAAACTCAGG + Intergenic
1118979025 14:70701277-70701299 GTGGTCCAGGAAAGAAACTCAGG - Intergenic
1119319971 14:73724824-73724846 GAGTTACTGGAAGGCAACTCTGG + Intronic
1121245784 14:92459989-92460011 GGGGCGCTGGAAGGAATCACAGG + Intronic
1121339832 14:93098800-93098822 GGAGTGCTGGAGGGAAGCTCGGG - Intronic
1121566588 14:94914625-94914647 TTGGAGCTGGAATGAAACCCAGG + Intergenic
1121645007 14:95511977-95511999 TTTGAGCTGGAAGGAACCTCAGG - Intergenic
1122427286 14:101619493-101619515 GTGGTCCAGGCAGAAAACTCTGG + Intergenic
1202933472 14_KI270725v1_random:61459-61481 CTGGTTCAGGAAGGAAATTCGGG - Intergenic
1123469039 15:20536579-20536601 GTGGCGCTGGAAGGGACCCCAGG + Intronic
1123649020 15:22464112-22464134 GTGGCGCTGGAAGGGACCCCAGG - Intronic
1123729314 15:23131567-23131589 GTGGCGCTGGAAGGGACCCCAGG + Intronic
1123747482 15:23329049-23329071 GTGGCGCTGGAAGGGACCCCAGG + Intergenic
1124279843 15:28352901-28352923 GTGGCGCTGGAAGGGACCCCAGG + Intergenic
1124302855 15:28558703-28558725 GTGGCGCTGGAAGGGACCCCAGG - Intergenic
1124495131 15:30181620-30181642 GGGGAGCTGGAAGGAAACTTAGG + Intergenic
1124748436 15:32357025-32357047 GGGGAGCTGGAAGGAAACTTAGG - Intergenic
1126671969 15:51124640-51124662 TTTGTCCTGGAAGGAAACCCTGG + Intergenic
1127631082 15:60828194-60828216 GTGCTGCTGGTGGGAAAGTCAGG + Intronic
1127961390 15:63893515-63893537 GGGGTGCTGCATGGAAACCCTGG - Intergenic
1128218139 15:65948343-65948365 GTGGAGCTGGAAGAATGCTCAGG - Intronic
1129526287 15:76217260-76217282 GTGGACTTGGAAGGAAAGTCAGG - Intronic
1129605507 15:77023092-77023114 GGGGTGCTGTAAGGAATCGCAGG - Intronic
1129856270 15:78827573-78827595 GCCCTGCTGGAAGGAAACCCTGG + Intronic
1132339253 15:101067701-101067723 GTGGTTCTGGAAGCAAGATCTGG + Intronic
1133902155 16:9986963-9986985 GTGGTGCTGGAAGGAAACTCGGG - Intronic
1134013830 16:10874700-10874722 GTGGTACTGAAACGAACCTCTGG + Intergenic
1135600095 16:23775650-23775672 TTGGGGCTGGAAGGAATTTCTGG + Intergenic
1136552195 16:30987714-30987736 GTGGTGTTGCAAGGGCACTCAGG + Intronic
1136628745 16:31477135-31477157 GAGGTGCTGCTAGGAACCTCGGG + Intronic
1137487187 16:48901427-48901449 TGGGAGCAGGAAGGAAACTCTGG + Intergenic
1138304138 16:55958607-55958629 GGGTTCCTGGAAGGAAAGTCAGG + Intergenic
1138372271 16:56536564-56536586 ATGGAGCAGGAAGGGAACTCAGG + Intergenic
1138933493 16:61690939-61690961 GTGAGGCTGGAGAGAAACTCAGG - Intronic
1141753415 16:85975138-85975160 GTGGTGCTGGCAGAAAAGCCAGG + Intergenic
1143658765 17:8312310-8312332 GGGGTGCTGGAAGGTGAGTCTGG - Exonic
1144287900 17:13796355-13796377 GTGGTGCTGTAGGGAAATTTTGG - Intergenic
1144413744 17:15025773-15025795 CTGGAACAGGAAGGAAACTCAGG - Intergenic
1145257429 17:21334330-21334352 GTGGTGCTGAAAAACAACTCAGG - Intergenic
1145319213 17:21753705-21753727 GTGGTGCTGAAAAACAACTCAGG + Intergenic
1146635454 17:34501044-34501066 ATAGTGCAGGAAGGAAACTGAGG - Intergenic
1147341582 17:39755838-39755860 GTGGTGGTGGATGGGAACTAGGG - Intergenic
1147430033 17:40365169-40365191 GTAAAGCTGGAAGGAAACTTGGG - Intergenic
1148841922 17:50504257-50504279 GTGGCGCTGGGAGGAGACTGCGG + Intergenic
1148906609 17:50916380-50916402 GTGGGGATGGAAAGAAACTCTGG + Intergenic
1151272593 17:73008441-73008463 GAGGAGCTGGAAGGACACTTGGG - Intronic
1151292332 17:73159548-73159570 GTGGTCCAGGAAGCACACTCTGG + Intergenic
1153089512 18:1328047-1328069 GTGGGGCTGGAATCAAACACTGG - Intergenic
1153834252 18:8949961-8949983 GAGGTGCGGGAAGCAAACTGCGG + Intergenic
1154329826 18:13420857-13420879 CTGGTGCTGGAAGGCACCTCAGG + Intronic
1155570199 18:27184806-27184828 GGGGCGCAGGAAGGAAACTCAGG + Intronic
1157177964 18:45468210-45468232 GTGGGGCTAAATGGAAACTCAGG + Intronic
1157210669 18:45739464-45739486 GATGTTCTGGAAGGAAACTGAGG - Intronic
1157526119 18:48383867-48383889 GTGAGGCTGGAAGGGAGCTCTGG + Intronic
1157629034 18:49078834-49078856 ATGATGCCGGATGGAAACTCAGG - Intronic
1158545059 18:58389180-58389202 GTGGTTCTGGAAGGTAACTCCGG + Exonic
1158643764 18:59225243-59225265 GAGGTGCTGGAACCAAACCCAGG + Intronic
1159411747 18:68085523-68085545 GTGGTTCTGGAGAGAAAGTCTGG - Intergenic
1160263319 18:77316130-77316152 GTGGTGCATGAAGAAAACCCTGG - Intergenic
1160405711 18:78645137-78645159 GGGGTGCAGGATGGAAACCCTGG - Intergenic
1161636691 19:5393664-5393686 GAAATTCTGGAAGGAAACTCAGG - Intergenic
1164471847 19:28542833-28542855 ATTGTGCTGGAAGGACACTGTGG - Intergenic
1165146962 19:33736936-33736958 GTGGTGATGGAAGCAACCTCCGG + Intronic
1165816975 19:38648277-38648299 GGGGTGCTGGGAGGAGAATCAGG + Intronic
1167560410 19:50223496-50223518 GTGGGGCTGGAAGCAGAGTCAGG + Intronic
1168393138 19:56027077-56027099 GTGGTTCTGCACGGAAAGTCAGG + Exonic
925377122 2:3394679-3394701 TTGGTGCTGGAAGGACTCACTGG - Intronic
926430556 2:12780995-12781017 CTGGGGCTGGAAGGCGACTCTGG - Intergenic
927295145 2:21445187-21445209 TGGGTTCAGGAAGGAAACTCAGG + Intergenic
928219939 2:29395308-29395330 GTGGTCCTGTAAGCAAATTCTGG + Intronic
928404799 2:31006525-31006547 GAGGTGCTGGGATGAAACCCAGG + Intronic
929907375 2:46058102-46058124 TTAGAGCTGGAAGGAACCTCAGG + Intronic
931263929 2:60643754-60643776 TTGGAGCTGGAAGTAAAGTCCGG - Intergenic
931721111 2:65068476-65068498 GTGGTGATGGAGGGAAGCTGTGG - Intronic
932694648 2:73945252-73945274 CTGATGGTGGAAGGAATCTCAGG - Intronic
934043066 2:88146168-88146190 GTGGAGCTGGAAGAGAACTTGGG + Intergenic
934993862 2:98939503-98939525 GTGGTACTGAAAGGAAGCCCAGG - Intergenic
935689165 2:105714896-105714918 GTGGAGCTGGAAAGGAGCTCAGG + Intergenic
939789418 2:146553049-146553071 GAGGTGCGGGAAGGAAATTGAGG + Intergenic
941588125 2:167384960-167384982 GTGGTGGTGGGAGGAGACTGAGG - Intergenic
942130374 2:172872873-172872895 GTGAAGCTGGAAGGAAAAGCAGG - Intronic
942421759 2:175815100-175815122 GTGGTGCAGGATGTTAACTCGGG - Intergenic
945073126 2:206011228-206011250 CTGGTGCTGGAGGGAAAGCCTGG - Intronic
946160225 2:217831379-217831401 GTGGTTCTGGACAGAAACCCGGG - Intronic
947302145 2:228700170-228700192 GTGGTGGTGGAGGGAAAATGTGG - Intergenic
948888215 2:240894335-240894357 GTTGTCCTGGAAGGGAACTGGGG - Intronic
1172310248 20:33912643-33912665 GTGGTTGTTGAAGGAAACTTGGG - Intergenic
1172625894 20:36346531-36346553 GTGGTGCAGGCAGGAAAAACAGG + Intronic
1173150726 20:40564725-40564747 GTTGAGCTGGAAGGAACCTAGGG - Intergenic
1174518969 20:51115129-51115151 GTGGTGGTGGAAAAAAATTCTGG + Intergenic
1175332461 20:58174980-58175002 GGGGCTCTGGAAGGCAACTCTGG - Intergenic
1175839722 20:62019300-62019322 GGGGAGCTGGCAGGGAACTCGGG - Intronic
1176594870 21:8683614-8683636 CTGGTTCAGGAAGGAAATTCGGG - Intergenic
1178480405 21:32975275-32975297 GTGATGCAGGAAGGAGATTCGGG - Intergenic
1180141760 21:45897541-45897563 GTGGTCATGGAAGGAAAAGCCGG - Intronic
1180277725 22:10660776-10660798 CTGGTTCAGGAAGGAAATTCGGG - Intergenic
1180470174 22:15646552-15646574 GTAGAGCAGGAATGAAACTCAGG + Intergenic
1180584959 22:16879606-16879628 CTGGTTCAGGAAGGAAATTCGGG - Intergenic
1182620227 22:31614772-31614794 GTGTTGCTGGAAAGAAACATGGG - Exonic
1182705828 22:32279830-32279852 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1182967426 22:34535317-34535339 TTGGTGCTGGAATAAGACTCTGG - Intergenic
1183838113 22:40473963-40473985 GTGATGCTGGAAAGTAACCCAGG - Intronic
1184394160 22:44222900-44222922 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1184938002 22:47739273-47739295 GTGGTTCTGGAAGGAAACCAGGG + Intergenic
950181371 3:10915713-10915735 ATGGGGCTGGAAGGGACCTCAGG + Intronic
950371711 3:12536492-12536514 GAGGTGCTGGGAAGAAACTTGGG + Intronic
952220927 3:31323700-31323722 GTGGTGCAAGAGGGAAACTTGGG + Intergenic
953240076 3:41140896-41140918 GAGGTGCTAGAAAGACACTCTGG + Intergenic
953476491 3:43209848-43209870 ATGGACCTGGAAGAAAACTCTGG - Intergenic
953625205 3:44565358-44565380 GTGGGGCTGGAAGGACACCCTGG + Intronic
954906767 3:54069849-54069871 GTGGTCCTGGTAGGAACCTCTGG + Intergenic
955578176 3:60388960-60388982 GTGGTGCTGGAGGGACAGACAGG - Intronic
955838864 3:63089927-63089949 GTGGGGGTGGAAGGCAGCTCTGG + Intergenic
955939696 3:64135771-64135793 GTGATGCTGGTAGAAAACTGGGG + Intronic
956171363 3:66436176-66436198 GTAGTGCTGGAAGAAGACACAGG - Intronic
956945551 3:74218466-74218488 GTGGTGTAGGAATGAACCTCAGG - Intergenic
958862375 3:99459873-99459895 TTGGTGATGGAAGTAAGCTCTGG + Intergenic
958893950 3:99809709-99809731 ATGATGCTGGATGGAATCTCTGG - Intergenic
960246113 3:115402348-115402370 TTGGGGCTGGAAGGGAACTTAGG - Intergenic
960294359 3:115925073-115925095 GTGGACTTGGAAGGAAACCCAGG - Intronic
961135544 3:124506672-124506694 GAGGTGCTGGAGGAAAACCCAGG + Intronic
961479420 3:127170555-127170577 GACCTGGTGGAAGGAAACTCGGG + Intergenic
961655314 3:128438589-128438611 GTGGTTCTGGACTGAAACTTGGG + Intergenic
964065761 3:152577008-152577030 GTGGTGCTTGAATGACACCCTGG - Intergenic
964137500 3:153361270-153361292 TTAGTGCTAGAAGGAAACTGAGG + Intergenic
965851350 3:173029480-173029502 ATGGTGGTGAAAGGAAGCTCAGG + Intronic
969470874 4:7388589-7388611 GAAATGCTGGAAGGAAACACAGG - Intronic
973639631 4:52890102-52890124 GTAGGGCTGGAAGGAAGGTCTGG - Intronic
974018474 4:56671819-56671841 ATAGAGCTGGAAGGAGACTCCGG - Intronic
974710340 4:65585016-65585038 CTGGAGCTGGAGGGAAACTTAGG - Intronic
977198081 4:94085662-94085684 CTGGTTCTGGAATGAGACTCGGG + Intergenic
981915209 4:150025591-150025613 GTGGGGCTGGAATTAAACGCAGG - Intergenic
982774700 4:159429729-159429751 GGGGTGCTGGAAGGATAAGCAGG - Intergenic
986056861 5:4146725-4146747 GTGAGGCTGGACGTAAACTCTGG - Intergenic
986566965 5:9124888-9124910 ATGGTTCTGGAAGAGAACTCTGG - Intronic
987219888 5:15780290-15780312 GTGTTACTGGAAGGAACCCCAGG + Intronic
987987360 5:25164716-25164738 GTGGTTCTAGAAGGAAAAACTGG - Intergenic
989459083 5:41676190-41676212 GTGATGATCCAAGGAAACTCTGG - Intergenic
989571420 5:42949558-42949580 GTGCTGCTAGAAAGAAACTGCGG + Intergenic
989576751 5:42994998-42995020 GTGCTGCTAGAAAGAAACTGCGG - Intergenic
990186528 5:53215812-53215834 GTTCTCCTGGAAGGAGACTCTGG - Intergenic
990859442 5:60310527-60310549 GTGTTCCTGGAAGGAAAGTGAGG - Intronic
992006706 5:72485555-72485577 ATGATCCTGGAAGGAACCTCTGG - Intronic
992911743 5:81401644-81401666 GTGGTGCTGCAGGCAAACTGGGG + Intergenic
993667861 5:90722949-90722971 GGGGACCTGGTAGGAAACTCAGG + Intronic
994004475 5:94821686-94821708 GTGGTCCTGGAACCAATCTCTGG - Intronic
994450102 5:99930136-99930158 ATGGAGCCAGAAGGAAACTCTGG - Intergenic
996350297 5:122532955-122532977 GTGGTGGTGGTAGGAAAATAGGG - Intergenic
999429652 5:151515229-151515251 GTGATGCTGGAGGAAAACCCAGG - Intronic
1001283933 5:170408876-170408898 AAGGTGCTGGAGGGAAAGTCAGG + Intronic
1001941399 5:175742312-175742334 GTGGTGATGGAAGGATACCAAGG + Intergenic
1002469663 5:179427865-179427887 GAGGTGCAGGCAGGAAACTGCGG - Intergenic
1004432866 6:15561864-15561886 ATGGTGATGGAAGGGACCTCTGG + Intronic
1007118511 6:39361585-39361607 GGGGTGTTGGAAAGAAACTAAGG + Intronic
1009618982 6:66046862-66046884 GTGGTGCTGTAACAAAACTTTGG + Intergenic
1010685636 6:78852116-78852138 TTGGTTCAGGAAGGAAAGTCTGG + Intergenic
1011720064 6:90146789-90146811 ATTGTCCTGTAAGGAAACTCTGG + Intronic
1013172258 6:107647356-107647378 GTGGTTTTGCATGGAAACTCTGG - Intronic
1013289069 6:108705455-108705477 GTGGAGCTGGAAGGATGCTGGGG - Intergenic
1015619590 6:135117123-135117145 GGGGTGAGGGGAGGAAACTCAGG + Intergenic
1016825472 6:148384854-148384876 ATGGGGGTGGGAGGAAACTCTGG - Intronic
1017873188 6:158503174-158503196 GTGGGGCTGGCAGGAGACTTGGG - Exonic
1018856082 6:167676406-167676428 GTGGTGTTGGGAGGAGACTGTGG - Intergenic
1019791327 7:3015752-3015774 GTGGTTCTGGAATGAGAGTCTGG - Intronic
1025175862 7:56802156-56802178 GGGCTGCTGGAAGGAAAAGCTGG + Intergenic
1025695931 7:63774266-63774288 GGGCTGCTGGAAGGAAAAGCTGG - Intergenic
1026412260 7:70135871-70135893 GAGATGCTGGAAGTAAAATCTGG + Intronic
1028877822 7:95843389-95843411 ATGGTGTAGGGAGGAAACTCAGG - Intronic
1031456231 7:121983209-121983231 GTGGTGATGGCAGGAAATCCTGG + Intronic
1032505324 7:132430082-132430104 GTTGTGCTGCATAGAAACTCAGG - Intronic
1032521704 7:132550416-132550438 TTTGTGCTGGAAGGAATCTGGGG + Intronic
1034889588 7:154827985-154828007 GTGGTGCTGGACTGGAACTGGGG + Intronic
1035127576 7:156619515-156619537 GTGGACCTGGAAGGAAACTGAGG - Intergenic
1035153966 7:156897350-156897372 TTAGTGCTGGAAGGAACATCAGG - Intergenic
1035410558 7:158637393-158637415 GGGGTGCTGGAAGGTCACTGGGG + Intronic
1036599297 8:10245119-10245141 GGGGAGCTGAAAGGAAATTCTGG + Exonic
1036607903 8:10324070-10324092 GTGGTGCTGAAAGGAAGCACTGG - Intronic
1040320239 8:46290746-46290768 GTGCAGCTGGGAAGAAACTCAGG - Intergenic
1040568638 8:48589101-48589123 GTGGTGATGGTAAGTAACTCCGG - Intergenic
1043885812 8:85599311-85599333 GTGCTGGTGAAAGGAAAATCTGG + Intergenic
1047290282 8:123523749-123523771 GTGGTACTGGAAAGAAAATCAGG + Intronic
1047695608 8:127400880-127400902 GTGGAGCTGGAAGGGAAATCAGG - Intergenic
1049751991 8:144289299-144289321 GGGGGGCTGCAAGGAAACACTGG + Exonic
1051029468 9:12657661-12657683 GTGGGGTTGGAAGGAAGTTCTGG - Intergenic
1051221953 9:14858182-14858204 GTGGACCTGGAAGGATACGCAGG - Intronic
1052381202 9:27773050-27773072 GTGGAGCTGGAAGTAAAGTGTGG - Intergenic
1053273948 9:36769478-36769500 GTGGTTCTGGACACAAACTCAGG + Intergenic
1053468659 9:38329333-38329355 GAAATGCTGGAAGGAAACTGTGG + Intergenic
1053693900 9:40617256-40617278 CTGGTTCAGGAAGGAAATTCAGG - Intergenic
1053940889 9:43247682-43247704 CTGGTTCAGGAAGGAAATTCGGG - Intergenic
1054270937 9:63022880-63022902 CTGGTTCAGGAAGGAAATTCAGG + Intergenic
1054305145 9:63416480-63416502 CTGGTTCAGGAAGGAAATTCAGG - Intergenic
1054403890 9:64740460-64740482 CTGGTTCAGGAAGGAAATTCAGG - Intergenic
1054437511 9:65225970-65225992 CTGGTTCAGGAAGGAAATTCAGG - Intergenic
1054492892 9:65796011-65796033 CTGGTTCAGGAAGGAAATTCAGG + Intergenic
1054797629 9:69317184-69317206 GTGAAGCTGAAAGGGAACTCAGG - Intergenic
1056675826 9:88676290-88676312 GTTGTGTTGGAATGAAACACAGG - Intergenic
1056838233 9:89975415-89975437 GTAGGGCTGGAAGGAAACTTGGG - Intergenic
1059386240 9:113966807-113966829 GTGGTGCTGCTGGGAAACTGGGG - Intronic
1060298117 9:122356719-122356741 ATAGAGCTGGAAGGAAACTGAGG - Intergenic
1061063463 9:128262800-128262822 GTGGCACTGGAAGGAACCCCAGG + Intronic
1061418682 9:130461783-130461805 GTGGTGCTGGGTGGTTACTCAGG - Intronic
1061514082 9:131078639-131078661 GTGGTGCTGGAAGCAGAACCTGG - Intronic
1186727039 X:12368193-12368215 GTGTTGTGGGAAGGAAACTGAGG - Intronic
1188864129 X:35293341-35293363 GTGATCCTGGAAGGAAACTAAGG + Intergenic
1189225690 X:39411417-39411439 GTGGTTCTGAAGGGAAACCCAGG + Intergenic
1192151640 X:68716465-68716487 GTGGTGCCATAAGGAAACCCAGG + Intronic
1194946274 X:100072138-100072160 TTGGAGCTGGAATCAAACTCAGG + Intergenic
1195885762 X:109635954-109635976 GTGGTGGTGGAGGGACACTTGGG - Intronic
1198774560 X:140165959-140165981 GTGATGTTGGAAGGTACCTCTGG - Intergenic
1200758937 Y:7018429-7018451 GATGTGATGGAAGGAAACACAGG + Intronic
1201191675 Y:11448799-11448821 CTGGTTCAGGAAGGAAATTCGGG - Intergenic