ID: 1133905168

View in Genome Browser
Species Human (GRCh38)
Location 16:10015825-10015847
Sequence CCCTACCACATGGTTTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133905168_1133905175 20 Left 1133905168 16:10015825-10015847 CCTCATTAAACCATGTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1133905175 16:10015868-10015890 CACTGTAATCCCAGCTCTTTGGG 0: 2
1: 383
2: 9650
3: 333211
4: 353572
1133905168_1133905174 19 Left 1133905168 16:10015825-10015847 CCTCATTAAACCATGTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1133905174 16:10015867-10015889 ACACTGTAATCCCAGCTCTTTGG 0: 4
1: 198
2: 1272
3: 19630
4: 350107
1133905168_1133905176 23 Left 1133905168 16:10015825-10015847 CCTCATTAAACCATGTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1133905176 16:10015871-10015893 TGTAATCCCAGCTCTTTGGGAGG 0: 1775
1: 298238
2: 328399
3: 307186
4: 311163
1133905168_1133905173 -7 Left 1133905168 16:10015825-10015847 CCTCATTAAACCATGTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1133905173 16:10015841-10015863 GGTAGGGTAGCTGGGCATAGTGG 0: 1
1: 0
2: 2
3: 36
4: 432
1133905168_1133905178 29 Left 1133905168 16:10015825-10015847 CCTCATTAAACCATGTGGTAGGG 0: 1
1: 0
2: 1
3: 11
4: 88
Right 1133905178 16:10015877-10015899 CCCAGCTCTTTGGGAGGTCGAGG 0: 20
1: 4070
2: 129267
3: 283006
4: 329493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133905168 Original CRISPR CCCTACCACATGGTTTAATG AGG (reversed) Intronic
900805294 1:4763617-4763639 CCCACCCACATGGCTGAATGCGG - Intronic
900944252 1:5820888-5820910 CACTGCCACATGGTTTGCTGGGG - Intergenic
901777789 1:11572351-11572373 CCCTGCCATGTGGGTTAATGTGG + Intergenic
910950464 1:92641756-92641778 CCCTACCACATGCTGTAAACAGG + Intronic
913063075 1:115225677-115225699 CCCTTCCAGATGCTTTACTGGGG - Intergenic
918473850 1:184902857-184902879 CCATATCACAGGGTTTCATGAGG + Intronic
919846457 1:201645625-201645647 CCCTCTCCCATGGTTTAATTTGG - Intronic
920816082 1:209333382-209333404 CCCTACCCCATGCCTTAATGTGG - Intergenic
922627919 1:227070122-227070144 GCCTACCAAAAGATTTAATGTGG - Intronic
923264523 1:232301318-232301340 CCCTTTCATCTGGTTTAATGTGG + Intergenic
1065990539 10:31005351-31005373 TGCTACCACATGGATGAATGTGG + Intronic
1067180146 10:43979172-43979194 GGCTACCACATTATTTAATGAGG - Intergenic
1068839034 10:61589554-61589576 CACTTCCAAATGTTTTAATGAGG - Intergenic
1070616258 10:77971614-77971636 CCATTCCTCATGGTTCAATGTGG - Intronic
1071404671 10:85318472-85318494 CCCGAGCACATGATTTAAGGAGG + Intergenic
1073831830 10:107393399-107393421 CCCCACCACTTGGTCTAATGTGG + Intergenic
1075844142 10:125531595-125531617 CCCTGCCGCCTGATTTAATGAGG + Intergenic
1079852901 11:25559950-25559972 CCACACCAAAAGGTTTAATGTGG + Intergenic
1080278903 11:30533576-30533598 CTCTACCACTTGGCTCAATGAGG - Intronic
1080999146 11:37645833-37645855 CCATACCACATGGATTAAACTGG - Intergenic
1087611973 11:100445732-100445754 ACCTACCACCTGTTTTTATGTGG + Intergenic
1087834001 11:102851700-102851722 TTCCACCACATGGGTTAATGTGG - Intergenic
1095232951 12:39763683-39763705 CTCTACCACATGGACTTATGAGG + Intronic
1096340321 12:50792839-50792861 ACCTACCACATGCTTTATGGAGG + Intronic
1106440536 13:29763190-29763212 CCTTACCACATGGTTTTCCGTGG - Intergenic
1107346361 13:39465706-39465728 CCATCCCACATGGTTTACAGGGG + Intronic
1107899271 13:44995944-44995966 CCTTTCCTCATGGTTTAGTGGGG - Intronic
1113424688 13:110198437-110198459 CCCTCAGAAATGGTTTAATGTGG - Intronic
1114915734 14:27262728-27262750 CCTCACTAAATGGTTTAATGAGG + Intergenic
1121057989 14:90876695-90876717 CCCTACCAGATGGTTTGAGAAGG + Intronic
1126329445 15:47516090-47516112 CCATTCCACATGGCTCAATGGGG - Intronic
1130212599 15:81938758-81938780 CCCTACCACAGGGGTTAACCAGG + Intergenic
1130865117 15:87926918-87926940 CCTTTCCACTTTGTTTAATGGGG - Intronic
1131552759 15:93372228-93372250 ACCTACCATGTGATTTAATGGGG + Intergenic
1131943884 15:97597955-97597977 CCCTACCATCTGGCTTAATCTGG + Intergenic
1133905168 16:10015825-10015847 CCCTACCACATGGTTTAATGAGG - Intronic
1141752867 16:85970743-85970765 ACCTATCACATGGTGTTATGAGG + Intergenic
1147778572 17:42922325-42922347 CCCTTCCACTTGGTTTGTTGTGG + Intergenic
1154162654 18:11991466-11991488 GCCTATCACATGGTGTCATGTGG - Intronic
1154965891 18:21355779-21355801 CTTTATGACATGGTTTAATGTGG + Intronic
1157764863 18:50288219-50288241 CCCTTCCACATGTATTAATGGGG + Intronic
1162048501 19:8017582-8017604 CCCTTCCTCATGGATTAATGTGG - Intronic
1162310813 19:9906171-9906193 CCCTTCCAGATGGATTGATGGGG + Intronic
1164857971 19:31539651-31539673 CCCCACCACAAAGTTTATTGGGG - Intergenic
925195592 2:1922237-1922259 CCCTAGCTCATGTTTTCATGAGG + Intronic
932021735 2:68094474-68094496 CCCTGCCACATGCTCTAATATGG + Intronic
932498771 2:72161613-72161635 CCCTACCCCATGGTTTCCTGAGG - Intergenic
937168996 2:119846101-119846123 GCCTACCATATGGTTTATTGTGG + Intronic
940860337 2:158764591-158764613 TCCTATCAGATTGTTTAATGTGG + Intergenic
943335271 2:186606087-186606109 CAATACCATATAGTTTAATGTGG - Intronic
943338370 2:186646320-186646342 CCCTACCCCTAGTTTTAATGAGG + Intronic
944991320 2:205239439-205239461 CTCAACCCCATGGTCTAATGAGG - Intronic
946059261 2:216927606-216927628 CCCTCACACATGGCTTCATGAGG - Intergenic
946134079 2:217631309-217631331 CGCTAACACATGGATTTATGTGG - Intronic
1170394430 20:15910774-15910796 ACCTACCACATGGTTTGTAGAGG + Intronic
1175115618 20:56679754-56679776 CCCTTCCACCTGCTTTGATGGGG + Intergenic
1182330828 22:29550722-29550744 CCCTACCACAGGGGTTGTTGTGG + Intronic
949373622 3:3363005-3363027 GACTACCGCCTGGTTTAATGGGG + Intergenic
951429669 3:22591744-22591766 CCCCACCTCATGGTGTAATAGGG + Intergenic
959352346 3:105281593-105281615 CTCTCCCTCCTGGTTTAATGAGG - Intergenic
961604904 3:128086336-128086358 CCCTGCCTCATGGGTTACTGGGG + Intronic
962225250 3:133600779-133600801 CCTGAGCACAAGGTTTAATGAGG - Exonic
962256549 3:133873624-133873646 CTCTACCCCAAGGTTTACTGAGG + Intronic
963784069 3:149515295-149515317 CTCAACCCCATGGTTTAATCGGG - Intergenic
965809452 3:172577016-172577038 CCCCACCAAATGGTTTCATTTGG + Intergenic
969898947 4:10330487-10330509 ACCTTCCACATAGTTTAAGGTGG + Intergenic
971356758 4:25902036-25902058 CCTGACCACATGGTCTAAAGGGG - Intronic
971635781 4:29055515-29055537 CCCTATAACATGGTTTAAACAGG + Intergenic
972855367 4:43099232-43099254 ACCTACTCCATGGTTTATTGTGG - Intergenic
972992645 4:44840786-44840808 ACCAACCACATGGTATAAGGTGG - Intergenic
978910404 4:114056407-114056429 CCCTAACATATGGTTTATTCTGG + Intergenic
979619782 4:122786090-122786112 CCTTAGCACATGTTTTGATGGGG - Intergenic
981667729 4:147248417-147248439 CCCTACCACATAGGTGCATGGGG + Intergenic
987832714 5:23117516-23117538 CCCAACCACATAGTCTACTGGGG - Intergenic
992018344 5:72598083-72598105 ACCTTCCACAGGATTTAATGAGG - Intergenic
992675773 5:79104486-79104508 TACTACCACTTGGTTCAATGGGG + Intronic
994382633 5:99089337-99089359 CCCTAACACATTGTATAATGTGG + Intergenic
997979774 5:138461674-138461696 CCCAACCACATGGATTAAGGTGG + Intergenic
999283826 5:150382286-150382308 CCCTACCACATGCTTCAGGGAGG - Intronic
1005028010 6:21482574-21482596 CCCTACCACATGCTGTAATGGGG - Intergenic
1013717698 6:112982952-112982974 TCCTAACACATGATTCAATGAGG - Intergenic
1016300188 6:142621997-142622019 TCCTATCACATGGTTTGATTAGG - Intergenic
1022143378 7:27512956-27512978 CCCTACCCCATTCTTTGATGTGG - Intergenic
1026159859 7:67859327-67859349 CCCTCCCCCATGGTTCAGTGTGG - Intergenic
1027188916 7:75986918-75986940 CCCCACCACATGGGTTCCTGGGG - Exonic
1028789147 7:94834043-94834065 CCCTACCATAGGCTTCAATGTGG + Intergenic
1031552592 7:123133390-123133412 CCCCTCCACTTGGTTTAATGTGG - Intronic
1034907639 7:154964788-154964810 CCCAGCCACATGGCTTAATATGG + Intronic
1035367400 7:158358027-158358049 CCCTCCCACAAGGCTTAAGGTGG + Intronic
1036573496 8:10002661-10002683 CCCCATCACATGGTTTAAGGAGG - Intergenic
1036725748 8:11219113-11219135 TCCTACCACATGGATAAATCTGG - Intergenic
1040357994 8:46638270-46638292 CCCTCCCACATGGTGAATTGTGG + Intergenic
1041373409 8:57188737-57188759 CCCTTCCACATGTTTTGATGGGG - Intergenic
1044735533 8:95274616-95274638 CCCTACCATATGGACTCATGGGG - Intergenic
1057036384 9:91814654-91814676 CCCTACCATTTGACTTAATGAGG - Intronic
1059358356 9:113718845-113718867 CCCTCCCACAAGGTTTCTTGTGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1193350291 X:80456029-80456051 ACCTACCACATATTTTCATGAGG + Intergenic
1196062503 X:111426219-111426241 CCACACCACATGGTTTCATCAGG - Intergenic
1197111663 X:122782001-122782023 CCCTAGCTCATGTTTTAATCAGG - Intergenic
1197259360 X:124300970-124300992 GCCTACCATATGGTTTATTCTGG + Intronic