ID: 1133909338

View in Genome Browser
Species Human (GRCh38)
Location 16:10050727-10050749
Sequence TTTTTCCACAGACCGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1085
Summary {0: 1, 1: 19, 2: 128, 3: 297, 4: 640}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133909338_1133909347 20 Left 1133909338 16:10050727-10050749 CCCAACCCCGGTCTGTGGAAAAA 0: 1
1: 19
2: 128
3: 297
4: 640
Right 1133909347 16:10050770-10050792 CCCTGGTGCCAAAAAGATTGAGG 0: 67
1: 1195
2: 1695
3: 1238
4: 840
1133909338_1133909344 3 Left 1133909338 16:10050727-10050749 CCCAACCCCGGTCTGTGGAAAAA 0: 1
1: 19
2: 128
3: 297
4: 640
Right 1133909344 16:10050753-10050775 TCTTCCACGAAACTGGTCCCTGG 0: 95
1: 688
2: 1087
3: 1509
4: 1213
1133909338_1133909343 -4 Left 1133909338 16:10050727-10050749 CCCAACCCCGGTCTGTGGAAAAA 0: 1
1: 19
2: 128
3: 297
4: 640
Right 1133909343 16:10050746-10050768 AAAACTGTCTTCCACGAAACTGG 0: 33
1: 373
2: 1033
3: 962
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133909338 Original CRISPR TTTTTCCACAGACCGGGGTT GGG (reversed) Intronic
900587235 1:3439110-3439132 TTTTTCCAAAGACCAGGGGATGG + Intergenic
900836224 1:5006387-5006409 TTTTTCCACGGACCAGGGGAGGG + Intergenic
901304534 1:8223160-8223182 TTTTTCCACAGCCGGGGGCTGGG - Intergenic
901578984 1:10224891-10224913 TTTTTCCACAGACAGGGTTGGGG + Intronic
901895286 1:12306749-12306771 TTTTTCCACAGACAGGGTTGGGG + Intronic
902647410 1:17809888-17809910 TTTTTCCACAGACCTGGAGTAGG - Intronic
902703542 1:18189413-18189435 TTTTTCCACAGACCAGGGCAGGG + Intronic
902803872 1:18848963-18848985 TTTTTCCACAGACTGGGAGGAGG - Intronic
903088360 1:20884898-20884920 TTTTTCCACAGACCAGGGTTGGG + Intronic
903694976 1:25199885-25199907 TTTTTCCAAAGCCCTGGATTTGG - Intergenic
903701936 1:25255559-25255581 TTTTTCCACAGCTGGGGGTGGGG + Intronic
903703867 1:25270560-25270582 TTTTTCCATGGACCGGGGTGAGG - Intronic
903723375 1:25422764-25422786 TTTTTCCATGGACCGGGGTGAGG + Intronic
903842082 1:26250431-26250453 TTTTTCCACAGACGATGGTTGGG - Intronic
904035361 1:27556000-27556022 TTTGTCCACAGACCAGGGCTAGG - Intronic
904097504 1:27992253-27992275 TTTTTCCATGGACCTGGGTGGGG + Intronic
904353054 1:29921374-29921396 TTTTTCCACAGACGGGGGTGGGG + Intergenic
905688946 1:39928647-39928669 TTTTTCCACAGACTGGGGTGCGG - Intergenic
905998260 1:42401035-42401057 TTTTTCCACAGATGGGGGTGGGG + Intronic
906390500 1:45411313-45411335 TTTTTCCACAGACTCGGGTGAGG + Intronic
906497984 1:46319129-46319151 TTTTTCAAAAGACAGGGTTTTGG + Intergenic
906702301 1:47868686-47868708 TTTTTCCACAGTCTAGGGTGAGG - Intronic
906833906 1:49062160-49062182 TTTTTCCATCGACGGGGGTTGGG - Intronic
907257402 1:53190418-53190440 TTTTTCCATGGACGGGGGTTGGG - Intergenic
907495778 1:54843339-54843361 TTCTTCCACAGACCAGGGTAGGG - Intergenic
908287825 1:62628059-62628081 TTTTTCCACAGATGGGGTTGTGG + Intronic
908343437 1:63206292-63206314 TATTTCCACAGACCGGAGTCGGG - Intergenic
908415731 1:63911588-63911610 TTTTTCTATGGACCAGGGTTGGG - Intronic
908611768 1:65868926-65868948 TTTTTCCACAGACGGGGTGGTGG - Intronic
909617364 1:77626253-77626275 TTTTTCCACAGACTGGGTGATGG + Intronic
909711172 1:78651133-78651155 TTTTTCCACAGACTGGTGGTGGG + Intronic
909712274 1:78665572-78665594 TTTTTCCACAGACCAGTGGTGGG + Intergenic
910222168 1:84898601-84898623 TTTTTCCATGGACAGGGGTGGGG + Intergenic
910687268 1:89930077-89930099 TTTTTCCAGAAATGGGGGTTGGG - Intronic
910884242 1:91949294-91949316 TTTTTGCACCGCCCGGGGCTGGG + Intergenic
911719729 1:101177818-101177840 TTTTTCCACAGAGTGGGTTGGGG - Intergenic
911903125 1:103530062-103530084 TTTTTCCACAGGCTGGGGTGGGG - Intronic
912356317 1:109056842-109056864 TTTTTCTACGGACTGGGGTGAGG - Intergenic
912975629 1:114327508-114327530 TTTTTCCATGGACCTGGGTAGGG - Intergenic
913554577 1:119952287-119952309 TTTTTCCATGATCCGGGGTTGGG + Intronic
914319901 1:146549112-146549134 TTTTTCCACAGATTGGGGGTGGG - Intergenic
914381079 1:147117054-147117076 TGTTTCCACAGAGCAAGGTTGGG - Intergenic
914398283 1:147291471-147291493 TTTTACCTCAGACCTGAGTTTGG + Exonic
915962076 1:160275282-160275304 GTTTTCCACAGAGGGGGGTGGGG - Intergenic
916124436 1:161556776-161556798 TTTTTCCTCGGACAGGGGTAGGG + Intergenic
916134328 1:161638126-161638148 TTTTTCCTCGGACAGGGGTAGGG + Intronic
916619212 1:166477564-166477586 TTTTTCCACAGAGTGGGGTGGGG + Intergenic
916705632 1:167346500-167346522 TTTTTCCACAGACAGCGAGTAGG + Intronic
917072349 1:171165933-171165955 TTTTTTAAGAGACAGGGGTTTGG + Intergenic
917169654 1:172157006-172157028 TTTTTCCACAGATCAGGATGAGG + Intronic
917762871 1:178182834-178182856 TTTTTCCATGGACTGGGGTGGGG + Intronic
917780707 1:178393155-178393177 TTTTTCCACGGACCAGGGTTGGG + Intronic
917850621 1:179060632-179060654 ATTTTCCACAGACAGGGGTTGGG - Intronic
918016982 1:180644729-180644751 TTTTTCCACATACCAGGGGGAGG + Intronic
918476630 1:184932165-184932187 TTTTTCCATGGACCAGGGTTGGG + Intronic
918581881 1:186140890-186140912 TTTTTCTACAGATCGAGGGTTGG + Intronic
919501385 1:198341833-198341855 TTTTTCCACAGACGAGGAGTAGG + Intergenic
919801469 1:201357184-201357206 TTTTTCCATGGACAGGGGTGGGG - Intergenic
919852611 1:201683370-201683392 TTTTTCCACGGACAGGGGTTGGG + Intronic
920510445 1:206547675-206547697 TTTTTCCATGGACTGGGGTGGGG - Intronic
920524324 1:206655608-206655630 TTATCCCACAGACTGGGGTCTGG - Intronic
920553638 1:206886817-206886839 TTTTTCCACAAACAGGAGTTGGG - Intergenic
921005993 1:211094127-211094149 TTTTTCCATGGACTGGGGGTGGG + Intronic
921151862 1:212409138-212409160 TTTTTCCACAGATGGAGGTTGGG - Intronic
921322423 1:213954907-213954929 TTTTTCCACAGACCGGGGTGGGG + Intergenic
921638787 1:217527217-217527239 TTTTTCCACAGACTGGGGGTAGG - Intronic
922093709 1:222422864-222422886 TTTTTCCATGGACTCGGGTTGGG - Intergenic
922111827 1:222566349-222566371 TTTTTCCACAGACCAGTGTGAGG + Intronic
922275314 1:224072179-224072201 TTTTTCCATGGATAGGGGTTGGG + Intergenic
922293258 1:224226819-224226841 TTTTTCCACAGACAGGGTCAGGG + Intergenic
922501686 1:226101596-226101618 TTTTTCCACAGACTGGGGTAAGG - Intergenic
922607853 1:226902096-226902118 TTTTTCCACAGATAGGGGTTGGG + Intronic
922865349 1:228856021-228856043 TTTTTCCACAGACCAGGGATGGG - Intergenic
923084676 1:230694502-230694524 TTTTAGCACAGACCGGGATGAGG + Intergenic
923616744 1:235544654-235544676 TTTTTCCACAGATGTGGGGTGGG - Intergenic
923704459 1:236332740-236332762 TTTTTCCACAGACAGTGTGTAGG - Intergenic
924194109 1:241587119-241587141 TGTTTCCACAGACAGGGGGTGGG + Intronic
924202067 1:241670840-241670862 TTTTTCCACGGACCAGGGCAGGG - Intronic
924375517 1:243403915-243403937 TTTTTCCACGGACCAGGGTAGGG - Intronic
924551626 1:245083306-245083328 TTCTTCCACAGACCAGGGGAGGG - Intronic
1063400168 10:5736118-5736140 TTTTTACAGAGACCAGGTTTTGG + Intronic
1063499456 10:6539680-6539702 TTTTTCCACAGACTGGGGTGGGG - Intronic
1063604670 10:7512208-7512230 TTTTTCCACAGACAGTGGAGGGG + Intergenic
1064115782 10:12576383-12576405 TTTTTCCACTGACCGGAGGAGGG + Intronic
1064265947 10:13825572-13825594 TTTTTCCATGGACCAGGGTGGGG - Intronic
1064269491 10:13852110-13852132 TTTTTCCACAGATGGGGTGTGGG - Intronic
1064280199 10:13944534-13944556 TTTTTCCAAGGACTGAGGTTGGG - Intronic
1064310395 10:14207289-14207311 TTTTTCCACGGATGGGGGTGGGG + Intronic
1064368154 10:14726810-14726832 TTTTTCCACAGACCAGGGTGTGG + Intronic
1064449901 10:15432312-15432334 TTTTTCCACAGACCGGTGGGCGG - Intergenic
1064605038 10:17030288-17030310 TTTTTCCACGGACCGGGGGTGGG - Intronic
1064679646 10:17797035-17797057 TTTTTCCACAGCCAGGGTTGGGG - Exonic
1064738329 10:18406758-18406780 TTGTTCCATGGACTGGGGTTTGG - Intronic
1065009924 10:21411705-21411727 TTTTTCCACAGATGCGGGGTGGG + Intergenic
1065284371 10:24173454-24173476 TTTTTACACAGACGAGGGTCAGG - Intronic
1065631163 10:27682601-27682623 TTTTCCCACGGACCAGGGATGGG + Intronic
1065631417 10:27684789-27684811 TTTTTCCACAGACCGGGGAGCGG + Intronic
1065672561 10:28136280-28136302 TTTTTCCACAGATGGGGGTTTGG - Intronic
1065679094 10:28210678-28210700 ATTTTCCACAGAGCAGGCTTTGG - Intronic
1065754641 10:28919958-28919980 TTTTTCCACGGACTGGGGCAGGG + Intergenic
1065755582 10:28927600-28927622 TTTTTCCACAGACCCAGGACAGG + Intergenic
1065939563 10:30551759-30551781 TTTTTCCACAGACTGGGGTGGGG + Intergenic
1066214193 10:33270028-33270050 TTTTTCTACTGACAGGGTTTGGG - Intronic
1066352379 10:34648489-34648511 TTTTTCCACAAATGGGGGCTTGG + Intronic
1068017882 10:51541106-51541128 TTTTTCCACAGAGCAGGGTTGGG + Intronic
1068194130 10:53694380-53694402 TTTTTCCACAGACGGGGGTAGGG + Intergenic
1068505149 10:57891081-57891103 TTTTTCCACAGATGGTGGTGGGG - Intergenic
1068603308 10:58978450-58978472 TTTTTCCACAGACTGGGAGGCGG + Intergenic
1068861790 10:61855168-61855190 TTTTTCCACAGACGTAGGTGGGG - Intergenic
1068959219 10:62849878-62849900 TTTTTCCACAGATGGGGGCTGGG - Intronic
1069130255 10:64692077-64692099 ATTTTTCACAGTCCAGGGTTTGG + Intergenic
1069136509 10:64773160-64773182 TTTTTCCTCAGACAGGGGTGGGG - Intergenic
1069218616 10:65854412-65854434 TTTTTCCACAGATTGGGGGTTGG + Intergenic
1069357269 10:67601264-67601286 TTTTTCCACAGATGGTGGATGGG + Intronic
1069572348 10:69501983-69502005 TTTTTCCACAGGATGGGGTGCGG - Intronic
1069981056 10:72252872-72252894 TGTTTCCCAGGACCGGGGTTTGG - Intergenic
1070402818 10:76068406-76068428 TTATTCCACAGACTGGGGGTGGG + Intronic
1071136174 10:82457255-82457277 TTTTTCCACAGACAGGTGGTAGG + Intronic
1071671073 10:87610053-87610075 TTTTTCCATGGACCAGGGTGGGG - Intergenic
1071866573 10:89740947-89740969 TTTTTCCATGGACCAGGGTAGGG + Intronic
1072056051 10:91756958-91756980 TTTTTCCACAGATGGGGATGGGG + Intergenic
1072256884 10:93629611-93629633 TTTTTCCACAGAATGAGGGTGGG + Intronic
1072332697 10:94369234-94369256 TTTTTCCACAGATCAGGGTGGGG + Intergenic
1072604973 10:96973244-96973266 TCTTTCCACAGAACTGGCTTAGG - Intronic
1072672330 10:97439703-97439725 TTTTTCCACAGACCATGGAGGGG - Intronic
1072844847 10:98818287-98818309 TTTTTCCACAGGCTGGGGGTGGG + Intronic
1073642966 10:105271478-105271500 TTTTTCCACAGACAGGGGGCAGG + Intergenic
1074069590 10:110052559-110052581 TTTTTCCACAGACTGGGGGTCGG - Intronic
1074124555 10:110517683-110517705 TTTTCCCACAGACGGGGTTCGGG - Intergenic
1074289756 10:112129593-112129615 TTTTTCTATGGACGGGGGTTGGG - Intergenic
1074507495 10:114084568-114084590 TTTTTCCAAAGACCAGGGTAGGG + Intergenic
1075141588 10:119842168-119842190 TTTTTCCATGGACCGGAGTGGGG - Intronic
1075304638 10:121356744-121356766 TTTTTTCACAGACCGGCAGTGGG - Intergenic
1075517880 10:123123787-123123809 TTTTTCCAGGGGCTGGGGTTAGG - Intergenic
1075565187 10:123498237-123498259 TGTTTCCAAAGACATGGGTTTGG - Intergenic
1075880600 10:125847585-125847607 TTTTTCCACAGACCAGAGGGTGG + Intronic
1075927815 10:126267291-126267313 TTTTTCCATGGACCAGGGGTGGG + Intronic
1075993474 10:126857765-126857787 TTTTTCCATGGAATGGGGTTGGG - Intergenic
1076048770 10:127315706-127315728 CTTTTCCACATAGCTGGGTTGGG + Intronic
1076057372 10:127386768-127386790 TTTTTCCATGGACCGGGGTGGGG - Intronic
1076284900 10:129285309-129285331 TTCTTCCACACACTGGGGTCAGG + Intergenic
1076415071 10:130280222-130280244 TTTTTCCACAGACCCAGGGTGGG - Intergenic
1076621231 10:131789447-131789469 TTTCTCCACAGACTGGGGGTGGG - Intergenic
1077400887 11:2356535-2356557 TTTTTCCACAGACCCGGAGTTGG - Intergenic
1077643423 11:3902418-3902440 TTTTTCCACAGACCAGGGTGCGG + Intronic
1077860845 11:6178479-6178501 TTTTTCCACAGACAGGGGAAGGG - Intergenic
1077901599 11:6494476-6494498 TTTTTCCACGGACCAGGGGAGGG - Intronic
1078342775 11:10511416-10511438 TTTTTCCACAGACCAGGGTTGGG - Intergenic
1078366387 11:10710031-10710053 TTCTTCCACAGCCCAGAGTTGGG + Intergenic
1078592278 11:12653551-12653573 TTTTTCCACAGACCAAGGTAGGG + Intergenic
1078812689 11:14784126-14784148 TTTTTCCACAGACTGGGTAGGGG - Intronic
1080046016 11:27809148-27809170 TTATTCCACAGACTGGGGTTGGG + Intergenic
1080242877 11:30147242-30147264 TTTTTCCACAGATGGGGGTGGGG + Intergenic
1080244474 11:30164036-30164058 TTTTTCCACAGACTGGGTAGTGG + Intergenic
1080244540 11:30164504-30164526 TTTTTCCACAGACCAGGTGGTGG + Intergenic
1080454514 11:32406208-32406230 TTTTTCCACAGACCAGGGGTGGG + Intronic
1080466494 11:32502370-32502392 TTTTTCCACAGACCAGGGGGTGG - Intergenic
1080492595 11:32782302-32782324 TTTTTCCACAGACTGGGGCTGGG - Intronic
1080512440 11:32988237-32988259 TCTTTCCACAGACCAGGAGTGGG - Intronic
1080723650 11:34873284-34873306 TTTTTCCACAGATGGGGGCAGGG - Intronic
1080878526 11:36298252-36298274 TTTTTCCACAGACCAGGGTAGGG + Intronic
1081045273 11:38266592-38266614 TTTTTCCACAGACAGTGCTGGGG + Intergenic
1081262397 11:40976845-40976867 TTTTTCCACAGACTGGGGCAGGG + Intronic
1081281183 11:41210841-41210863 TTCTTCCACTGATGGGGGTTGGG + Intronic
1082769931 11:57199995-57200017 TTTTTCCACACGCCTGGGATGGG - Intergenic
1082841385 11:57692951-57692973 TTTTTCCACAGATGGGGGCTGGG + Intronic
1082900535 11:58245527-58245549 CTTTTCCACGGACTGAGGTTGGG - Intergenic
1083149739 11:60784301-60784323 TTTTTCCATGGGCCGGGGTGGGG - Intergenic
1083576676 11:63796900-63796922 TTTTTCCACAGACAGGGTTGGGG + Intergenic
1085211387 11:74782539-74782561 TTTTTCCACTGACTGGTGTAGGG - Intronic
1085219526 11:74861665-74861687 TTTTTCCATGGACTGGGGTGGGG - Intronic
1085885607 11:80518286-80518308 TTTTTCCACATACTGGGGGTGGG - Intergenic
1085898076 11:80663651-80663673 TTTTTCTACAGACTAGGGTGGGG - Intergenic
1087160396 11:94942888-94942910 TTTTTCCACAGATGGTGGGTGGG + Intergenic
1087428393 11:98019182-98019204 TTTTTCCACAGACTGGTGTTGGG + Intergenic
1087454850 11:98372113-98372135 TTTTTCCACAGACCAGGGTTGGG + Intergenic
1088482119 11:110304145-110304167 TTTTTCCACAGACTGGCGGGCGG - Intergenic
1089181389 11:116585386-116585408 TTTTTCCACAGACCAGGGTGGGG - Intergenic
1090330764 11:125930479-125930501 CTTTTCCACGGACAGGGGTGTGG - Intergenic
1090435353 11:126682596-126682618 TTTTTCCATGGACCTGGGTAGGG + Intronic
1090591132 11:128270210-128270232 TTTTTCCACAGATTGGGGGTGGG - Intergenic
1090704825 11:129326689-129326711 TTTTTCCACAGACCAGGGGGTGG + Intergenic
1091541612 12:1467590-1467612 TTTTTCCACAGACAGGGGAGTGG + Intronic
1091858139 12:3755501-3755523 TTTTTCCATGGACCAGGGGTGGG + Intronic
1091942281 12:4498715-4498737 TTTTTCCACAGACTGGAGTTGGG + Intronic
1091942606 12:4501818-4501840 GTTTTCCACAGACCGGGGGTTGG - Intronic
1092283086 12:7112180-7112202 TTTTTCCACAAACCAGGGATGGG - Intergenic
1092392262 12:8091270-8091292 GTTTTCCACAGACCGGCATTAGG + Intronic
1092734292 12:11565525-11565547 TTTTCCCACGGATGGGGGTTGGG - Intergenic
1093130585 12:15387348-15387370 TTTTTTAAAAGCCCGGGGTTGGG + Intronic
1093176365 12:15917734-15917756 TTTTTCCACAGACTGGGGTAGGG + Intronic
1093224537 12:16465777-16465799 TTTTTCCACAGATTGGGGTGGGG - Intronic
1093269659 12:17044523-17044545 TTTTTCCACGGACAGGGATGGGG + Intergenic
1093509740 12:19912308-19912330 TTTTTCCACAGACAAGGTTGGGG - Intergenic
1093661966 12:21767579-21767601 TTTTTCCACTGATGGGGGTGGGG - Intronic
1093766841 12:22973514-22973536 TTTTTCCACAGATGAGGGTGGGG + Intergenic
1094167444 12:27457041-27457063 TTTTTCCACAGACAGTGGGAGGG - Intergenic
1094719095 12:33044238-33044260 TTTTTCCACGGATGGGGGATGGG + Intergenic
1095183622 12:39175672-39175694 TTTTTCCATGGACTGGAGTTGGG - Intergenic
1095589605 12:43889005-43889027 TTTTTTCAGTGACCAGGGTTAGG + Intronic
1095757329 12:45783526-45783548 TTTTTCCACAGACTGTGGCAGGG + Intronic
1095764344 12:45877599-45877621 TTTTTCCATGGACCAGGGGTTGG - Intronic
1096184876 12:49572305-49572327 TTTTTCCACAGACAGGGGGTTGG + Intronic
1096403812 12:51328178-51328200 ATTTTCCACGAACCGGGGTGGGG + Intergenic
1097637991 12:62145448-62145470 TTTTTCCACGGACGGGGGTGCGG - Intronic
1097802368 12:63928640-63928662 TTTTTCCATGGACTGGGGGTGGG + Intronic
1097897236 12:64837252-64837274 TTTTTCCACAGACCAGGGCTTGG + Intronic
1098170504 12:67742212-67742234 TTTTTCCACAGACCAGGAAGCGG - Intergenic
1098370077 12:69749358-69749380 TTTTTCCACAGACAGGGCAGAGG - Intronic
1098606706 12:72399173-72399195 TTTTTCCACAGACAGAGGTGGGG - Intronic
1099222241 12:79929051-79929073 TTTTTCCACAGATGTGGGTTGGG + Intronic
1099260658 12:80377193-80377215 TTTTTCCACTTACAGGGCTTTGG - Exonic
1099536048 12:83846321-83846343 TTTTTCCACAAACTGGGGTTAGG + Intergenic
1099747994 12:86732311-86732333 TTTTTTCACAGACCGGGGTGGGG + Intronic
1100324634 12:93529485-93529507 TTTTTCTATAGACCAGGGGTCGG - Intergenic
1100324817 12:93530951-93530973 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1100432128 12:94540441-94540463 TTTTTCAACAGACTGGCCTTTGG + Intergenic
1100625617 12:96328394-96328416 TTTTTTCACAGACTGAGGTTGGG - Intronic
1100677990 12:96888805-96888827 TTTTTCCATGGACCAGGGTGGGG + Intergenic
1100715645 12:97302486-97302508 TTTTTCCATGGACTGGGGTGGGG + Intergenic
1100755869 12:97750398-97750420 TTTTTCCATAGACTGGGGATGGG + Intergenic
1100993685 12:100279150-100279172 TTTTTCCACAGATGGGGGATGGG + Intronic
1101262459 12:103046772-103046794 TTTTTCCACGGACTGGGGAAGGG - Intergenic
1101669100 12:106850195-106850217 TTTTGCCACAGACTGGGGCTTGG - Intronic
1101749057 12:107567843-107567865 TTTTTCCACAGACTGGGGGTAGG - Intronic
1101861117 12:108483255-108483277 TTTTTCCACGGACGGTGGGTGGG - Intergenic
1101955899 12:109212297-109212319 TTTTTCCACGGACCGGGGAGGGG + Intronic
1102363034 12:112305006-112305028 TTTTGTCACAGACCTGGCTTGGG + Intronic
1102919374 12:116780286-116780308 TTTTTCCACAGATCAGGGTGGGG + Intronic
1103226374 12:119291519-119291541 TTTTTCCACAGACGGGGTCAGGG - Intergenic
1103269248 12:119658518-119658540 TTTTTCCATGGACTAGGGTTGGG - Intergenic
1103860059 12:124005040-124005062 TTTTTCCACAGACTGGGGGCAGG - Intronic
1104141626 12:125992862-125992884 TTTTTCCATTGACCAGGGTGGGG + Intergenic
1104538522 12:129641141-129641163 TTTTTCCATGGACCGGGGCAGGG - Intronic
1104650638 12:130529742-130529764 GTTTTCCACAGACTGGGGTGGGG + Intronic
1104680290 12:130746482-130746504 TTTTCCCACAGACCGAGGTGGGG + Intergenic
1105863460 13:24438217-24438239 TTTTTCCATGGACAGGGGTGGGG + Intronic
1105912930 13:24887736-24887758 TTTTTCCATGGACTGGGGTAAGG - Intronic
1105983977 13:25547668-25547690 TTTTTCCACAGACTTGGGTGGGG - Intronic
1106257843 13:28037957-28037979 TTTTTCCATAGATTGGGGGTAGG - Intronic
1106397486 13:29394923-29394945 TTTTTCCACAGACAGGCGGGTGG - Intronic
1106623320 13:31392692-31392714 TTTTTCCATGGACCGGGGCGGGG + Intergenic
1106832772 13:33602886-33602908 TTTTTCTACAGCCAGGGGTTGGG - Intergenic
1106939871 13:34766368-34766390 TTTTTCCATGGACCAGAGTTGGG - Intergenic
1107437764 13:40395662-40395684 TTTTTCCATGAACCAGGGTTGGG + Intergenic
1107446219 13:40472314-40472336 TTTTTCCATAGACTGGGGTTGGG - Intergenic
1107593606 13:41937192-41937214 TTTTTCCACAGACTGGGGGGAGG + Intronic
1107729310 13:43332212-43332234 TTTTTCCATGGACAGGGGGTTGG + Intronic
1107895348 13:44956392-44956414 TTTTTCCAAAGACAGAGGGTGGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108320103 13:49281410-49281432 TTTTTCCACAGATGGGGTTATGG + Intronic
1108345867 13:49546435-49546457 TTTTTCCACGGACCGAGGCGGGG + Intronic
1108457812 13:50634177-50634199 TTTTTCCATGGACCCGGGGTGGG + Intronic
1108515182 13:51194785-51194807 CTTTTCCACAGACTGGAGTAGGG + Intergenic
1109176702 13:59166574-59166596 TTTTTCCACAGACTGGGGGGTGG - Intergenic
1110247497 13:73342870-73342892 TTTTTCCACAGACAGTGTGTGGG - Intergenic
1110358363 13:74595503-74595525 TTTTTCCACGGACTGGGGGTGGG + Intergenic
1110717359 13:78721392-78721414 TTTTTCCACAGACGAGGTTGGGG - Intergenic
1111694126 13:91601874-91601896 TTTTTCCACAGACCAGCATGGGG - Intronic
1112165175 13:96910427-96910449 TTTTTCCACAGCCCGGTGAGGGG - Intergenic
1112222684 13:97507042-97507064 TTTTTCCACAGACCATGGTTGGG - Intergenic
1113078163 13:106488849-106488871 TTCTTCCACTGACTGGGGTGTGG + Intergenic
1113126315 13:106983221-106983243 TTTTTCCACAAACTGGGGCTGGG - Intergenic
1113300363 13:109012581-109012603 TTTTTCCACGGACCAGGGGTGGG - Intronic
1113401465 13:109997923-109997945 TTTTTCCACAAACTGAGGTGGGG - Intergenic
1113626693 13:111853109-111853131 TTTCTCCACAGATGGGGGGTGGG - Intergenic
1113783557 13:112989863-112989885 CTTTTCCACAGATCAGGGGTAGG + Intronic
1113881235 13:113627825-113627847 TTTTTCCACAGACCGGAGTCGGG - Intronic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1114028530 14:18554061-18554083 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1114333307 14:21660103-21660125 TTTTTCCATGGACTGGGGGTGGG + Intergenic
1115308604 14:31957278-31957300 ATTTTCCACAGACAGGGAGTGGG - Intergenic
1115662454 14:35510797-35510819 TTTTTCCATGGACAGGGGTGGGG + Intergenic
1116423755 14:44764793-44764815 TTTTTCCACAGATCAGGGGTGGG - Intergenic
1116502674 14:45639349-45639371 TGTTTTCACAGACTGGGGTTGGG + Intergenic
1116976454 14:51121578-51121600 TTTTTCCATAGACTGGCTTTGGG + Intergenic
1117224633 14:53642500-53642522 TTTTTCCATGGACCGAGGTTAGG + Intergenic
1117527545 14:56624861-56624883 TATTTCCACAGACTGGGGGTTGG + Intronic
1117706537 14:58475397-58475419 TTTTTCCACAGACCAGGGCAGGG - Intronic
1117767744 14:59100477-59100499 TTTTTCCACAGACTGGGTCGGGG + Intergenic
1117851537 14:59976298-59976320 TTTTCCCCCAGACTGGGGATGGG - Intronic
1118187975 14:63554778-63554800 TTTTTCCACTGACTGGGGTGTGG + Intergenic
1118551694 14:66957979-66958001 TTTTTCTACGGACTGGGGGTTGG - Intronic
1118620719 14:67611760-67611782 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1119203753 14:72778602-72778624 TTTTTCCACCGACTGGGGTCGGG - Intronic
1119626185 14:76178412-76178434 TTTTTCCATGGACCCGGGTTGGG + Intronic
1119687688 14:76645588-76645610 TCTCTCCACAGACCAGGCTTTGG - Intergenic
1119772710 14:77230736-77230758 TTTTTCCATGGACCTGGGTGTGG - Intronic
1119989712 14:79182228-79182250 TTTTTCCATGGACTGGGGTTGGG + Intronic
1120635681 14:86948151-86948173 GTTTTCCACAGACTGGGGGGAGG + Intergenic
1120663708 14:87280545-87280567 TTTTTCCATGGACAGGGGTGGGG - Intergenic
1120680626 14:87476957-87476979 TTTTTCCATAGACCGGAGTAGGG + Intergenic
1120919552 14:89742490-89742512 TTTTTCCATGGACTGGGGTCAGG + Intergenic
1121038947 14:90729300-90729322 TTTTTCCAGAGGCTGGGGCTTGG + Intronic
1121270828 14:92637056-92637078 TTTTTCCACGGGCCAGGGGTGGG + Intronic
1121284994 14:92728182-92728204 TTTTTCCACACACAGGGGTGAGG + Intronic
1121358123 14:93231896-93231918 TTTTTCCACGGACAGGGGTCGGG - Intergenic
1121379830 14:93454351-93454373 TTTTTCCATTGACAGGTGTTAGG + Intronic
1121570087 14:94940798-94940820 TCTTTCCACCGAAAGGGGTTGGG + Intergenic
1121623570 14:95368433-95368455 TTTTTGCAGAGACAGGGTTTCGG - Intergenic
1121648681 14:95539194-95539216 TTTTTCCACGGACCAGGGAAGGG - Intronic
1121735120 14:96213041-96213063 TTGTTCAACAGTCCTGGGTTAGG + Intronic
1121944942 14:98111057-98111079 TTTTTCCACAGACAGCAGGTGGG + Intergenic
1122144003 14:99677997-99678019 TTTTTCCATGGATGGGGGTTGGG + Exonic
1122305461 14:100763264-100763286 TTTTTCCATGGACCAGGGTTGGG + Intergenic
1122468635 14:101950959-101950981 ATATTCCACAGACCAGGGTGGGG - Intergenic
1122825969 14:104370617-104370639 TCTTTCCACAGCGCGGGGTGTGG + Intergenic
1123065053 14:105614489-105614511 TTTTTCCACAGACCAAGATCGGG - Intergenic
1123069253 14:105633924-105633946 TTTTTCCACAGACCAGGATCGGG - Intergenic
1123088353 14:105729716-105729738 TGTTTCCACAGACCAGGATCGGG - Intergenic
1123094301 14:105759084-105759106 TTTTTCCACAGACCAGGATCGGG - Intergenic
1124096878 15:26656759-26656781 TTTTTCCACAGATGGGCGATTGG - Intronic
1124137972 15:27051673-27051695 TTTTTCCACGGACCAGGGCTGGG + Intronic
1124450077 15:29780114-29780136 TTTTTCCACAGACCGGCAGGTGG + Intronic
1124484982 15:30105697-30105719 TTTTTCCACAGACAAGGTTGGGG - Intergenic
1124518596 15:30391572-30391594 TTTTTCCACAGACAAGGTTGGGG + Intronic
1124540057 15:30574676-30574698 TTTTTCCACAGACAAGGTTGGGG - Intergenic
1124758593 15:32432901-32432923 TTTTTCCACAGACAAGGTTGGGG + Intergenic
1124808159 15:32907108-32907130 TTTTTCCACAGGCCAGGGGTTGG + Intronic
1124917866 15:33994507-33994529 TTTTTCCACAGACCAGGGTGAGG - Intronic
1124951297 15:34323578-34323600 TTTTTCCACAGACTAAGGTCGGG - Intronic
1125468384 15:39977248-39977270 TTTTTCCACAGACGGGTGTTAGG + Intronic
1126524118 15:49631160-49631182 TTTTTCCACAGACCAGGGTTTGG - Intronic
1126602231 15:50440473-50440495 TTTTTCAATGGACCAGGGTTAGG + Intronic
1126704214 15:51392590-51392612 TTTTTCCATAGACCGGGGTGTGG - Intronic
1127441884 15:59017151-59017173 TTTTTCCACAGACCCAGGGTGGG - Intronic
1127773865 15:62250900-62250922 TTTTTCCCCAGGCTGGGGGTGGG + Intergenic
1128110528 15:65073191-65073213 TTTTTCCACAGACAGCGGAGGGG + Intronic
1128406555 15:67346388-67346410 TTTTTCCACAGACAAGAGGTGGG + Intronic
1128963295 15:72031137-72031159 TTTTTCCACAGACTGGGGGATGG - Intronic
1129279200 15:74470518-74470540 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1129406255 15:75320564-75320586 TTTTTCCACAGACGGGGTTGGGG - Intergenic
1129703119 15:77779324-77779346 TTTTTCCACAGCCCAGGGTTGGG + Intronic
1129735217 15:77957055-77957077 TTTTTCCACAGACGGGGTTGGGG + Intergenic
1130195731 15:81778701-81778723 TTTTTCCACAGACCAGGGCGGGG + Intergenic
1130743135 15:86622726-86622748 TTTTTCCACAGACTACGGGTGGG + Intronic
1131008441 15:88997587-88997609 TTTTTACACAGAAAGGGGGTGGG - Intergenic
1131325472 15:91439370-91439392 TTTTTTCACAGATCAGGGTCAGG + Intergenic
1131714571 15:95094571-95094593 TTTTTCCACGGAACGGGGTTAGG + Intergenic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1133968007 16:10545781-10545803 TTTTTCTACAGACTGGGGAGGGG - Intronic
1133977310 16:10608491-10608513 TTTTTCCACAGATGGGGGTTGGG - Intergenic
1134128217 16:11630762-11630784 TTTTTCTAGAGACAGGGGTCGGG + Intronic
1134230980 16:12430204-12430226 TTTTTCCATGGACTGGGGCTGGG - Intronic
1134285920 16:12862173-12862195 TTTTTCCATGGACCGGGGTTAGG + Intergenic
1134601740 16:15538981-15539003 TTTTTCCATGGACCAGGGATGGG + Intronic
1134690288 16:16186793-16186815 TTTTCCCACGGACCGGGGAGAGG - Intronic
1135868271 16:26125269-26125291 TTTTTCCACAGATGGGGGTGGGG + Intronic
1136147923 16:28326658-28326680 TTTTTTCACGGACCAGGGGTGGG - Intergenic
1136545321 16:30951044-30951066 GTTTTCCACAGACAGGGATCTGG - Intronic
1137295116 16:47084966-47084988 TTTTTTCACAGAACAGGGGTGGG - Intronic
1137306232 16:47203339-47203361 TTTTTCCACGGACCAGGGGATGG + Intronic
1137322934 16:47404082-47404104 TTTTTCCACAGACGAGGCCTAGG - Intronic
1137945323 16:52728510-52728532 TTTTTTCACAGACCAGGGAGGGG + Intergenic
1138100987 16:54252439-54252461 TTTTTTCAGAGACTGGGGTGGGG - Intronic
1138425510 16:56929499-56929521 TTTTTCCACAGGCCAGAGGTGGG + Intergenic
1138437559 16:57012689-57012711 TTTTTCCCCGGACGGGGGTTGGG - Intronic
1138694248 16:58796863-58796885 TTTTTCCACAGACGAGGAGTTGG - Intergenic
1139120400 16:64009375-64009397 TTTTTCCACAGACCAGAGTTGGG + Intergenic
1139122152 16:64033544-64033566 TTTTTCCATGGACTGGGGCTGGG + Intergenic
1139375046 16:66491629-66491651 TTTTTCCACAGACAGGGTGGAGG + Intronic
1139392517 16:66613946-66613968 TTTTTCCATGGACTGGGGGTTGG + Intergenic
1140013625 16:71160965-71160987 TTTTTCCACAGATTGGGGGTGGG + Intronic
1140522906 16:75597511-75597533 TTTTTCCACAGATCCGGGGTGGG + Intronic
1141378862 16:83557387-83557409 TTTTTCCACGGACCAGAGTGGGG - Intronic
1142618168 17:1148683-1148705 TTTTTCCACGGACCGGGGAAGGG - Intronic
1143279482 17:5741810-5741832 TTTTTCCACGGACGGGGGTGGGG + Intergenic
1143602016 17:7953208-7953230 TTTTTCCACAGACAGGGGTGCGG + Intergenic
1143727667 17:8860488-8860510 TTTTTCCACGGAAGGGGTTTGGG - Intronic
1144523915 17:15973675-15973697 TGTTTCCACAGACCAGGGGCGGG - Intronic
1144557896 17:16298062-16298084 TTTTTCCATGGACAGGGGTGGGG - Intronic
1144584530 17:16480276-16480298 TTTTTCCATGGCCCGGGGTGGGG - Intronic
1144614072 17:16752318-16752340 TTTTTCCACAGACGGTGGGGTGG - Intronic
1144713615 17:17419549-17419571 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1144898638 17:18563349-18563371 TTTTTCCACAGACGGTGGGGTGG + Intergenic
1145000717 17:19302733-19302755 TTTTTCCACGGCCAGGGGTGGGG - Intronic
1145075893 17:19854334-19854356 TTTTTCCACAAACCTATGTTGGG - Intronic
1145133738 17:20382370-20382392 TTTTTCCACAGACGGTGGGGTGG - Intergenic
1145970566 17:28954053-28954075 TTTTTCCAGAGCCCATGGTTAGG + Intronic
1146168446 17:30612139-30612161 TTTTTCCATAGACCAGGCTGGGG + Intergenic
1146221413 17:31025639-31025661 TTTTTCCATAGACCAGGCTGGGG + Intergenic
1146689414 17:34862955-34862977 TTTTTCCATGGACTGGGGTGGGG - Intergenic
1146738117 17:35257100-35257122 TTTTTTCACGGATGGGGGTTGGG - Intronic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1147634807 17:41957263-41957285 TTTTTCCATGGACCGGTGGTGGG + Intronic
1147686817 17:42290908-42290930 TTTTTCCATGGACCGGGATTGGG + Intronic
1147916949 17:43893761-43893783 TTTTTCCACGGATCAGGGTGAGG - Intronic
1148531585 17:48398532-48398554 TTTTTCCATGGACCGGGGGTGGG - Intronic
1149025687 17:52025077-52025099 TTTTTCCATGGACCAGGGGTTGG - Intronic
1149140066 17:53421579-53421601 TTTTTCCACAGACTGGGGGAGGG - Intergenic
1149817737 17:59742936-59742958 GTTTTCCACAGACCTGAGGTGGG - Intronic
1149870530 17:60176773-60176795 TTTTTCCACGGACTGGGGGATGG + Intergenic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1150119956 17:62592667-62592689 TTTTTCCATGGACCGGGGACAGG + Intronic
1150209052 17:63431740-63431762 TTTTTCCACAGACCAGGGCTGGG - Intergenic
1150366387 17:64589868-64589890 TTTTTCCATAGACCAGGCTGGGG - Intronic
1150806742 17:68325490-68325512 TTTTTCCACAGACAGGGGTTGGG - Intronic
1150882202 17:69042886-69042908 TTTTTCCACAAACAGGAGTGGGG + Intronic
1151026759 17:70686017-70686039 TTTTTCCACAGACCAGGGTAGGG - Intergenic
1151230597 17:72682300-72682322 TTTTTCCATGGACTGGGGTGGGG - Intronic
1151267386 17:72967222-72967244 TTTTTCTACAGAGCGGGGGATGG - Intronic
1151279526 17:73062730-73062752 TTTTTCCACGGATTGGGGGTGGG + Intronic
1151394721 17:73815050-73815072 TTTTTCCACGGACTGGAGTGGGG + Intergenic
1151836712 17:76586649-76586671 TTTTTCCACGGAGGGGGGTGGGG + Intronic
1151945554 17:77318114-77318136 TTTTTCCACAGACCAGGGAGTGG - Intronic
1151984013 17:77530325-77530347 TTTTTCCACGGACCCGGGTGGGG + Intergenic
1152422327 17:80200617-80200639 CTTTTCCACAGACCGGGTTGTGG + Intronic
1153246965 18:3081976-3081998 TTTTTCCACAGACCAGGTCGGGG + Intronic
1153377184 18:4393758-4393780 TTTTTCCACAGACCGGGGGCAGG + Intronic
1153529077 18:6025654-6025676 TTTTTCCACAGACAGGGGCTTGG + Intronic
1153533813 18:6078696-6078718 TTTTTCCACAGACCAGGGGTGGG + Intronic
1153845250 18:9043607-9043629 TTTTTCCATGGATGGGGGTTGGG - Intergenic
1153953856 18:10079375-10079397 TTTTTCCACAGACCAGCGCGGGG - Intergenic
1154045627 18:10902201-10902223 TTTTTCCACGGATGGGGGTAGGG - Intronic
1154143030 18:11842364-11842386 TTTTTCCATGGACCGTGGTGGGG + Intronic
1154236241 18:12608956-12608978 TTTTTCCACAAATGGGGGTGGGG + Intronic
1154965295 18:21349892-21349914 TTTTTCCACAGCCAAGGGTTGGG - Intronic
1155107965 18:22686525-22686547 TTTTTCCAAAGACCAGGGTCGGG + Intergenic
1155908300 18:31478796-31478818 TTTTTCCACAGACGGCGGCAGGG + Intergenic
1155991051 18:32279713-32279735 TTTTTCCACGGACCTGGCGTTGG - Intronic
1156215726 18:34996255-34996277 TTTTTCCATAGACTGGGGGTAGG + Intronic
1156350096 18:36296329-36296351 TTTTTCCACGGACAGTGGTGGGG - Intergenic
1156432832 18:37094018-37094040 TTTTTCCACAGACCAGGGTGTGG + Intronic
1156623078 18:38875736-38875758 TTTTTCCACAGACTGTGGGATGG - Intergenic
1157449902 18:47778016-47778038 TTTTTCCGCAGACTGGGGAGGGG + Intergenic
1157474062 18:48010189-48010211 TTTTTCCACAGACAGGGCACAGG - Intergenic
1157778096 18:50412628-50412650 TTTTTCCATGGACCGGGGTTGGG + Intergenic
1157808583 18:50677183-50677205 TTTTTCCACGGACCGGGAAGAGG - Intronic
1158130816 18:54150598-54150620 TTTTTCCAAAGAGCAGGGTGGGG - Intergenic
1158193222 18:54854897-54854919 TTTTTTCACAGACTGGGATTGGG + Intronic
1158289500 18:55923387-55923409 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1158480903 18:57821058-57821080 TTTTTCCACAAACCAGGGTGGGG - Intergenic
1158595969 18:58816338-58816360 TTTTTCCACGGACCAGGGGTGGG + Intergenic
1158634074 18:59140532-59140554 TTTTTCCCCTGACCGTGGGTCGG + Intronic
1158684439 18:59600482-59600504 TTTTTCCACAGACCAGAGGTGGG - Intronic
1159014867 18:63093089-63093111 TTTTTCCACGGACAGGGGCCGGG - Intergenic
1159031133 18:63233462-63233484 TTTTTCCATAGACGGGGGTGGGG + Intronic
1159558320 18:69967854-69967876 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1159937272 18:74379242-74379264 TTTTTCCACAGACCAAGGTTGGG + Intergenic
1160213099 18:76900853-76900875 TTTTTCCACAGATTGGGGGTCGG + Intronic
1160271334 18:77387032-77387054 TTTTTCCACAGACCAAGGGTAGG - Intergenic
1160334260 18:78023491-78023513 TTTTTCCACAGACTGGGAGCGGG + Intergenic
1160369095 18:78356451-78356473 TTTTTCCACAGTCGGGGTTGAGG + Intergenic
1160398913 18:78594612-78594634 TTTTTCCACAGACTAGGGTAGGG + Intergenic
1160606830 18:80057938-80057960 TTTTCCCACAGACCGGGAAGGGG - Intronic
1160764381 19:800929-800951 TTTTGCCACAGGGCAGGGTTAGG + Intronic
1161093042 19:2372502-2372524 TTTTTCCAAAGACTGGGGGTGGG - Intergenic
1161125307 19:2552861-2552883 TTTTTCCACAGACAGTGGGGAGG - Intronic
1161862291 19:6807126-6807148 TTTTTCCATGGACCAGAGTTAGG + Intronic
1161997419 19:7721984-7722006 CTTTTCCACAGACTGGGGTGGGG + Intergenic
1162004817 19:7770878-7770900 TTTTTCCACGGACCAGGGGAAGG + Intergenic
1162091971 19:8286125-8286147 TTTTTCCACGGACCAGGGGTGGG + Intronic
1162094208 19:8300974-8300996 TTTTTCCACGGACCAGGGGTGGG + Intronic
1162259842 19:9523640-9523662 TTTTCCCACGGACTGGAGTTGGG + Intergenic
1162833262 19:13299846-13299868 TTTTTCCACAGACCTAGGTGTGG + Intronic
1163054141 19:14705858-14705880 TTTTTCCACAAAGCAGGGTAGGG - Intronic
1163120966 19:15217469-15217491 TTTTTCCACGGACCGGGGTAGGG + Intergenic
1163208262 19:15820406-15820428 TTTTTCCACGGACTGGGGTTGGG + Intergenic
1163384170 19:16989203-16989225 TTTTTCCACAGACGGGGGCACGG - Intronic
1164450209 19:28355362-28355384 TTTTTCCACAGACTAGGGAGGGG - Intergenic
1164579710 19:29427182-29427204 TTTTTCCACAGACCAGGGGAGGG - Intergenic
1165235836 19:34420894-34420916 TTTTTTCACAGACTGAGGTGGGG + Intronic
1165242477 19:34479902-34479924 TTTTTCCACAGACAGGGATGGGG - Intergenic
1165402656 19:35611867-35611889 TTTTTCCACAGTCTGGGGGATGG - Intergenic
1165410407 19:35657044-35657066 TTTTTCCACAGACAGGGTTGGGG + Intronic
1166233731 19:41441317-41441339 TTTTTCCATAGACTGGGGGTCGG + Intergenic
1166582621 19:43915783-43915805 TTTTTCCACAGACTGGGGTCGGG - Intronic
1166596021 19:44051143-44051165 TTTTTCCACGGACTGGGGAATGG + Intergenic
1166756463 19:45195383-45195405 TTTTACCAGAGACGGGGTTTTGG + Intronic
1167819892 19:51918029-51918051 TTTTTCCACATACTGGGGCAAGG + Intronic
1167998636 19:53426770-53426792 TTTTTCCACAGATGGGGGGATGG - Intronic
1168008760 19:53512881-53512903 TTTTTCCACAGACGGGGGGATGG - Intergenic
1168217313 19:54935898-54935920 TTTTTCCACAGACGGGTTTGGGG - Intronic
1168254771 19:55159350-55159372 TTGCTCCACAGACCGGGGCCAGG - Exonic
925462393 2:4074708-4074730 TTTTTCCATGGGCAGGGGTTGGG - Intergenic
925744183 2:7030701-7030723 TTTTTCCACAGACTGGGCAGGGG + Intronic
925891476 2:8438512-8438534 TTTTTCCATAGACTGGGGGTGGG - Intergenic
926236083 2:11045031-11045053 TTTTTCCATGGACCGGGGATGGG + Intergenic
926286548 2:11493293-11493315 TTTTTCCACAGACAGGGTGTGGG + Intergenic
926701543 2:15807449-15807471 TTTTTCCACCGACTAGGGGTGGG - Intergenic
927132221 2:20070361-20070383 TTTTTCCACGGACAGGGGTGGGG + Intergenic
927228062 2:20789875-20789897 TTTTTCCACAGACTGGGGAGGGG - Intronic
927597345 2:24408246-24408268 TTTTTCCACGGAATGGGGATGGG + Intergenic
927914936 2:26929594-26929616 TTTTTCCACAGACCAGGACAGGG - Intronic
928154722 2:28866381-28866403 TTTTTCCACAGACTGGGGAGAGG + Intronic
928208569 2:29305756-29305778 CTTTTCCACAGACCAGGGGCTGG + Intronic
928243262 2:29605138-29605160 TTTTTCCACGGACAGGGGGGTGG + Intronic
928660295 2:33495244-33495266 TTTTTCCACAGACAGGGCAGGGG + Intronic
928675258 2:33644669-33644691 TTTTTCCACAGACTGGGAGTGGG - Intergenic
929174637 2:38963885-38963907 TTTTTCCACAGACTGCGGAGGGG + Intronic
929184555 2:39080004-39080026 CTTTTCCACAGACTCGGGTGGGG + Intronic
929334497 2:40724435-40724457 TTTTTCCACAGACCAGGAGTGGG - Intergenic
929417358 2:41756967-41756989 TTTTTCCACAGACTGGAGGGGGG + Intergenic
929675160 2:43919251-43919273 TTTTTCCACAGACCAGGTTGTGG - Intronic
930797175 2:55405768-55405790 TTTTTCCACGGACCAGGGCGGGG - Intronic
931377297 2:61718882-61718904 TTTCTCCACAGACTGGGGTGGGG - Intergenic
932278385 2:70468922-70468944 TTTTTCCACAGACTTGGGAGAGG - Intronic
932725366 2:74175383-74175405 TTTTTCCACAGATCTGGTTGGGG - Intronic
933845542 2:86323630-86323652 TTTTTCCATGGATGGGGGTTGGG - Intronic
934625765 2:95849494-95849516 TTTTTCCACAGATGGGGGTTTGG + Intronic
934807807 2:97251824-97251846 TTTTTCCACAGATGGGGGTTTGG - Intronic
934818143 2:97348248-97348270 TTTTTCCACAAACTGGGGGGTGG - Intergenic
934829703 2:97505363-97505385 TTTTTCCACAGATGGGGGTTTGG + Exonic
935083544 2:99822825-99822847 TTTTTCCAGAGTTCGGGGTGGGG + Intronic
935725710 2:106022070-106022092 TTTTTCCACGGACAGGGATTAGG - Intergenic
935891315 2:107681806-107681828 TTTTTCCACAGACCAGGGTGGGG + Intergenic
936083125 2:109448773-109448795 TTTTTCCACAGACTGAGGCAGGG - Intronic
936631707 2:114210429-114210451 TTTTTCCACGGACGGGGGGCAGG + Intergenic
936689949 2:114874692-114874714 TTTTTCCATGGACCAGGGGTTGG - Intronic
937177713 2:119957513-119957535 TTTTTCCATGGAGTGGGGTTGGG - Intronic
937196501 2:120161909-120161931 TTTTTCCAAGGACCAGGTTTGGG - Intronic
937576915 2:123434911-123434933 TTTTTCCACAGACCATAGTGGGG + Intergenic
937850334 2:126626680-126626702 TTTTTCCACAGACTGGGTGGGGG + Intergenic
937902756 2:127034575-127034597 TTTTTCCACGGACTGGGATGGGG - Intergenic
938637848 2:133248821-133248843 CTTTTCCAAGGACCAGGGTTGGG - Intronic
938776057 2:134542650-134542672 TTTTTCCGCGGACTGGGGTTGGG - Intronic
938904804 2:135827546-135827568 TTTTTCCACAGACTTGGGGGAGG + Intronic
939370427 2:141292235-141292257 TTTTTCCACAGACCGGGATGGGG - Intronic
939848496 2:147276581-147276603 TTTTTCCACAGAAGGTAGTTGGG + Intergenic
940453270 2:153867540-153867562 TTTTTCCACAGACTGGGAGAGGG + Intergenic
940641581 2:156350165-156350187 TTTTTCCACGGACCTGCGGTCGG - Intergenic
941621920 2:167788252-167788274 TTTTTCCACAGTCCGGAAGTGGG + Intergenic
941676268 2:168346343-168346365 TTTTTCCACAGACCAGGCAGGGG - Intergenic
941949559 2:171139795-171139817 TTTTTCCATGGACCAGGGGTGGG + Intronic
943294327 2:186117593-186117615 TTTTTCCACAGACCGGAGGTGGG + Intergenic
943503251 2:188718853-188718875 TTATTCCAAAGACAGGGCTTTGG - Intergenic
943576249 2:189634071-189634093 TTTTTCCACAGACCAGGGGCCGG - Intergenic
944626589 2:201575847-201575869 TTTTTCCACAGACCAGCATGGGG - Intronic
944775830 2:202963517-202963539 TTTTTCCACGGACCAGGATGGGG + Intronic
944862757 2:203830427-203830449 TGTTTCCACAGAGCTGAGTTGGG + Intergenic
944886152 2:204064637-204064659 TTTTTCCACACACTGGGGGTGGG - Intergenic
945157372 2:206853613-206853635 TTTTTCCATGGACTGGGGTAAGG - Intergenic
945327602 2:208501025-208501047 TTTTTCCACTGACTGGAGTCAGG + Intronic
945458156 2:210072505-210072527 TTTTTCCACAGACAGGAGATTGG + Intronic
946385475 2:219381779-219381801 GTATTCCACACACCTGGGTTAGG + Intronic
946500720 2:220244675-220244697 TTTTTCCATGGACTGGGGTCGGG + Intergenic
946584558 2:221170253-221170275 TTTTTCCACAGACCTGGGGAAGG - Intergenic
946649471 2:221875249-221875271 TTTTTCCACGGATGGGGGTAGGG - Intergenic
946739798 2:222790249-222790271 TTTTTCCACAGACGGTGGCAGGG + Intergenic
946806422 2:223475258-223475280 TTCTTCCATGGACCGGGGCTGGG - Intergenic
947202513 2:227627287-227627309 TTTTTCCACAAACCAGGGCAGGG - Intronic
947218720 2:227772489-227772511 CTGTTCCACAGCCCGGGGATTGG - Intergenic
947406957 2:229788348-229788370 TTTTTCCACAGACATGGACTGGG - Intronic
947482411 2:230512659-230512681 TTTTTCCACAGACCGGGATGGGG + Intronic
947685725 2:232082577-232082599 TTTTTCCACAGACCAGAAGTAGG - Intronic
947704593 2:232264026-232264048 TTTTTCCACAGACCAGGGGTAGG + Intronic
947798507 2:232910218-232910240 TTCTTCCACAGACCAGGGGTGGG + Intronic
948394893 2:237638035-237638057 CTTTTCCACAGACCAGGGTGTGG + Intronic
948535788 2:238645685-238645707 TTTTTCCACAGACCGGGGAAGGG - Intergenic
948539807 2:238682526-238682548 TTTTTCCACAGATGGGGCTGGGG + Intergenic
948734739 2:239994628-239994650 TTTTTACACAGACTGGGGCGGGG - Intronic
948914437 2:241025299-241025321 TTTTTCCATGGACTGGGGTGGGG - Intronic
948926329 2:241101048-241101070 TTTTTCCACAGACTGGTGAGGGG + Intronic
949081535 2:242104487-242104509 TTTTTCCACAGACTGGGGCGAGG - Intergenic
1169166680 20:3430141-3430163 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1169456312 20:5755460-5755482 TTTTTCCATGGACTGGGGGTGGG - Intronic
1169557202 20:6763979-6764001 TTTTTCTACAGACCAGGTTGGGG - Intergenic
1169640007 20:7741246-7741268 TTTTTCCACAGATAGTGGTGGGG + Intergenic
1169812541 20:9622788-9622810 TTTTTCCACAGACAGGGGTGCGG - Intronic
1170233820 20:14079912-14079934 TTTTTCCACAGACTGGGGGTAGG - Intronic
1170453318 20:16508441-16508463 TTTTTCCACAGATAGGGGTAGGG + Intronic
1170501987 20:16983287-16983309 TTTTTCCACGGAGTGGGGGTGGG - Intergenic
1170670260 20:18426298-18426320 TTTTTCCACGGACCTGGTTGGGG - Intronic
1170742036 20:19066623-19066645 TTTTTCCACACACCAGGGGTGGG - Intergenic
1170979731 20:21200318-21200340 TTTTTCCATGGAGCGGGTTTAGG + Intronic
1172757077 20:37293131-37293153 TTTTTCCACAGACCTGGGGGTGG + Intronic
1172801284 20:37578043-37578065 TTTTTCCAAGGACCGGTGTGGGG - Intergenic
1173051959 20:39571867-39571889 TTTTTCCACAGGTCGGGGTCGGG + Intergenic
1173204431 20:40981511-40981533 GTTTTCCACAGATTGGGGTAAGG - Intergenic
1173206310 20:40997105-40997127 TTTTTCCACAGACAAGGGAAGGG + Intergenic
1173320892 20:41986011-41986033 TTTTTCCACAGTCAGGGGGATGG - Intergenic
1173926017 20:46781819-46781841 TTTTTCCACAGATGGGGGCAGGG + Intergenic
1174142824 20:48428456-48428478 TTTTTTCACAGACCAGGGATGGG + Intergenic
1174171938 20:48623186-48623208 TTTTTATAGAGACCGGGTTTCGG - Intergenic
1174455884 20:50648501-50648523 TTTTTCCACTGACCAGGGTGGGG + Intronic
1174635538 20:51996270-51996292 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1174679038 20:52386685-52386707 TTTTTCCACGGACCAGGGGATGG - Intergenic
1174795342 20:53517666-53517688 TTTTTTCACAGACCCGGGGGTGG - Intergenic
1174906460 20:54557263-54557285 TTTTTCCACAGACGGGGTTGGGG + Intronic
1174958006 20:55122718-55122740 TTTTTCCATGGATCGGGGTGGGG + Intergenic
1175729242 20:61342206-61342228 TTTTTCCACAGATCAGGGGTAGG + Intronic
1176308531 21:5137054-5137076 TTTTTCCACAGACAGGGTTGGGG - Intronic
1176973819 21:15295704-15295726 TTTTTCCTCGGACGGGGGGTGGG + Intergenic
1178306694 21:31496844-31496866 TTTTTCCATGGACTGGGGTGGGG + Intronic
1178341634 21:31790365-31790387 TTTTTCCATGGACTGGGGGTGGG + Intergenic
1178380644 21:32104859-32104881 TTTTTCCATGGACCAGGGGTTGG - Intergenic
1178415933 21:32405117-32405139 TTTTTCCAAAGATGGGGGTTGGG + Intergenic
1178997516 21:37417602-37417624 GTATTCCACAGGCAGGGGTTGGG - Intronic
1179046640 21:37850569-37850591 TTTTTCCACGGACCAGGGGCAGG - Intronic
1179405541 21:41122390-41122412 TTTTTCCACAGACCCAGGGTTGG + Intergenic
1179442130 21:41402575-41402597 TTTTTCCACAGACCAGTGAGGGG + Intronic
1179598030 21:42456228-42456250 TTTTTCCACAAACCAGGGTGGGG + Intergenic
1179848528 21:44124978-44125000 TTTTTCCACAGACAGGGTTGGGG + Intronic
1179898074 21:44374381-44374403 TTTTTCCACAGATGGGGGCGGGG + Intronic
1180452651 22:15481111-15481133 TTTTTCCACAGATGTGGGTCTGG + Intergenic
1181020112 22:20095654-20095676 TTTTTCCACAGACGGTGTTGGGG + Intronic
1181026086 22:20128563-20128585 TTTTTCCATGGACCAGGGGTGGG - Intergenic
1181846829 22:25717009-25717031 TTTTTCCACAGACGGGGATGGGG - Intronic
1182722543 22:32415033-32415055 TTTTTCCACTGACTGGGATTGGG + Intronic
1182725463 22:32441820-32441842 TTTTTCCATGGCCTGGGGTTGGG + Intronic
1182752882 22:32655856-32655878 TTTTTCCACTGACCAGGGATGGG - Intronic
1183461358 22:37952960-37952982 TTTTTCCACTGACGGAGGTGTGG - Intronic
1183571040 22:38653709-38653731 TTTTTACACAGACCTGGGATGGG - Intronic
1183756555 22:39772107-39772129 TTTTTCCACAGAACAGGGTGTGG + Intronic
1183896441 22:40973175-40973197 TTTTTCCATGGACCGGGGGTGGG + Exonic
1184623851 22:45706100-45706122 TTTTTCCATAGACAGGGGTGGGG - Intronic
1184706305 22:46215942-46215964 TTTTTCCACAGATGGGGGTGGGG - Intronic
1184883445 22:47327054-47327076 TTTTTCTGCAGACCGGGGTGGGG + Intergenic
1184932951 22:47694977-47694999 TTTTTCCAGAGACCAGGGCTGGG + Intergenic
949333782 3:2951239-2951261 TTTTTCCACAGATGGCGGGTGGG + Intronic
949395309 3:3608489-3608511 TTTTTCCACAGACCTGGGGAGGG - Intergenic
949931361 3:9080997-9081019 TTTTTCCATGGACCAGGGTGGGG - Intronic
950761677 3:15235538-15235560 TTTTTCCACAGACTGGGGGGTGG + Intronic
950995233 3:17489009-17489031 TTTTTCCATGGACCGGAGTCCGG - Intronic
951434749 3:22648773-22648795 TTTTTCCATGGACCGGGGTGGGG + Intergenic
951551426 3:23878908-23878930 TTTTTCCACAGATGGGGGGTGGG - Intronic
951628194 3:24689879-24689901 TTTTTCCACGGAACTGGGTGGGG - Intergenic
952163000 3:30714498-30714520 TTTTTCCACGGACCTGGTATTGG - Intergenic
952655896 3:35785119-35785141 TTTTTCCCCAGACCAAGCTTGGG - Intronic
952786988 3:37165372-37165394 TTTTTCCATGGACGGGGGTGGGG - Intronic
953309880 3:41866383-41866405 TTTTTCCATGGACCAGGGTTAGG + Intronic
953872561 3:46639952-46639974 TTTTTCCACAGACCAGGGTGGGG + Intergenic
953874378 3:46657658-46657680 TTTTTCCACAGACTAGGGGCGGG - Intergenic
954230848 3:49216199-49216221 TTTTTCCACAGACCAGGATACGG + Intronic
954308855 3:49748750-49748772 CTTTTCCACAGAACGGGTGTGGG + Intronic
954395840 3:50292820-50292842 TTTTTCCACTGCCTGAGGTTTGG - Exonic
954505738 3:51070959-51070981 TTTTTCCACGGATCGGGGGGAGG - Intronic
954725033 3:52601310-52601332 TTTTTCCACAGACAGGGATGGGG + Intronic
954766079 3:52917811-52917833 TTTTTCTACAGACTGGGGTGGGG - Intronic
955291973 3:57700588-57700610 TTTTTCCACAGACCAGAATGGGG + Intergenic
955698856 3:61663539-61663561 TTTTTCCATGGACCGGGGGTTGG + Intronic
955917970 3:63925551-63925573 TTTTTCCACTGACCAGGGTTGGG - Intronic
955935954 3:64102679-64102701 TTTTTCCACAGACTGGGGCCAGG - Intronic
956198125 3:66674043-66674065 TTTTTCCACAGACCGGGGTGAGG - Intergenic
956335820 3:68162271-68162293 TTTTTCCACAGATGGGGTTGGGG + Intronic
956438638 3:69258964-69258986 TTTTCCCACGGACCAGGGTTGGG + Intronic
956764427 3:72472457-72472479 TTTTCCCACAGACCGGGGTTGGG - Intergenic
958056509 3:88419228-88419250 TTTTTCCACAGACCAGGGGGTGG - Intergenic
958189187 3:90162624-90162646 TTTTTCCACAGATTGGTGGTGGG + Intergenic
958849566 3:99307667-99307689 TTTTTCCACAGACTGCAGGTGGG - Intergenic
959043222 3:101442295-101442317 TTTTTCCACAGACCACGGGATGG + Intronic
959181649 3:102987680-102987702 TTTTTCCACGGACAGGGGTGGGG + Intergenic
959577316 3:107948383-107948405 TTTTTCCATGGACTGGGGTTGGG - Intergenic
959634353 3:108546102-108546124 TTTTTACACACAAAGGGGTTGGG + Intergenic
959846844 3:111042727-111042749 TTTTTCCACAGACTAGGGTCAGG - Intergenic
960086138 3:113593461-113593483 TTTTTCCACAGACGGGGGTGGGG - Intronic
960326367 3:116300719-116300741 TTTTTCCACAAACTGGGGTAGGG - Intronic
960589108 3:119348332-119348354 TTTTTCCATGGACCAGGGTCAGG - Intronic
960652142 3:119962775-119962797 TTTTTCCACGGACCGGTGAGGGG + Intronic
960672909 3:120169343-120169365 TTTTTCCACAGATAGTGGTGGGG - Intronic
960728871 3:120702257-120702279 TTTTTCCATGGACAGGTGTTTGG + Intronic
961491763 3:127261324-127261346 TGTTTCCACAGAGCAGGGCTTGG - Intergenic
962181920 3:133214936-133214958 TTTTTCTACAGACCTGGGGTGGG - Intronic
962435564 3:135363294-135363316 TTCTTCCACAGACAGGGGAGAGG + Intergenic
962754335 3:138456753-138456775 TTTTCCCACAGACCGGGGGTGGG - Intronic
963154586 3:142082411-142082433 TTTTTCCATGGACTGGGGTGAGG - Intronic
963383217 3:144557862-144557884 TTTTTCTAGAGACGGGGTTTAGG - Intergenic
963624818 3:147658247-147658269 TTTTTCCACAGACCTGGAGTGGG + Intergenic
964058454 3:152490188-152490210 TTTTTCCAGAGACAGAGTTTTGG - Intergenic
964209625 3:154212580-154212602 TTTTTCCACAGACGGGTGGGGGG + Intronic
964792015 3:160461173-160461195 TTTGTCCACAGATCAGGGTTGGG - Intronic
964816010 3:160718744-160718766 TTTTTCTACGGACTGGGGTGGGG + Intergenic
965363868 3:167774775-167774797 TTTTTCAATAGACAGGGGTGAGG - Intronic
965435753 3:168648896-168648918 TTTTTCCACAGACCGGGGTAAGG - Intergenic
965971171 3:174558330-174558352 TTTTTCCACAGACTGGGTACGGG + Intronic
966163401 3:176991080-176991102 TTTCTCCACAGACTGGGGGTGGG + Intergenic
966177195 3:177151544-177151566 TTTTTCCACGGACAGAGGGTAGG - Intronic
966358440 3:179107448-179107470 TTTTTCCACAGACTGGGGTAGGG + Intergenic
966533659 3:181007790-181007812 TTTTTCCACAGACCGGAGGGAGG - Intergenic
966584235 3:181603737-181603759 TTTTTCCACAAACCAGGGGCAGG + Intergenic
966812043 3:183855509-183855531 TTTTTCCATAGACCAGGGGTGGG + Intronic
967602805 3:191409592-191409614 TTTTTCCATGGACCAGGGATGGG - Intergenic
968438153 4:606202-606224 TTTTTCCACAGACTAGGCGTCGG - Intergenic
969925939 4:10585926-10585948 TATTTCCACAGATGGGGGTGGGG + Intronic
970008854 4:11436670-11436692 TTTTTCCACAGACCCGGGTGGGG + Intergenic
970038808 4:11772502-11772524 TTTTTCCACAGACTGGGATGGGG + Intergenic
970514154 4:16810942-16810964 TTTTTCCACAGACTGGTGGGGGG + Intronic
970690396 4:18612966-18612988 TTTTTCCACAGATGAGGGTTGGG + Intergenic
970900484 4:21152901-21152923 TTTTTCCACAGACAGGGTTGGGG - Intronic
971384920 4:26133737-26133759 TTTTTCCATAGACTGGGGGCGGG - Intergenic
972269930 4:37501476-37501498 TTTTTCCACAACCAGGGGTGAGG - Intronic
972498600 4:39656960-39656982 TTTTTCCACCGGCTGGGGTAGGG + Intergenic
972536900 4:40007375-40007397 TTTTTCCACAGACATGTGGTGGG + Intergenic
972675091 4:41252317-41252339 TTTTTCCACGGACTGGGGGTGGG + Intergenic
972744836 4:41922760-41922782 TTTTTCCACAGACGGGAGTAGGG - Intergenic
973018077 4:45166385-45166407 TTTTTTCATAGACTGGGGGTGGG + Intergenic
973117466 4:46478877-46478899 TTTTTCCACGGACGGGGATGGGG - Intergenic
975133517 4:70851378-70851400 TTTTTCCACAGACCAGGGTAGGG - Intergenic
975249366 4:72160262-72160284 TTTTTCCATTGACCAGGGGTGGG - Intergenic
975343824 4:73271564-73271586 TTTTTCCACAGACCATTGTGGGG + Intergenic
975381712 4:73707987-73708009 TCTTTCCACAGACAAGGGGTAGG - Intergenic
975441795 4:74419703-74419725 TTTTTCCACAGACCAGGGGGTGG + Intergenic
975540485 4:75505056-75505078 TTTTTCCATGGACCGAGGTTGGG + Intronic
975605574 4:76150739-76150761 TTTTTACACTGACGGGGGGTGGG - Intergenic
975960745 4:79901560-79901582 TTTTTCCACAGACCGGGGGGTGG + Intronic
976122692 4:81800310-81800332 TTTTTCCACGGACCAGGGTGTGG + Intronic
976342350 4:83959250-83959272 TTTTTCCACAGACAGGGAGTGGG + Intergenic
976668125 4:87622252-87622274 TTTTTCCACAGACAGGGTCGAGG + Intergenic
976705595 4:88015943-88015965 TTTTTCCACAGACCTGGGGTAGG + Intronic
977476024 4:97510599-97510621 TTTTTCCATGGACTGGGGGTGGG + Intronic
977923584 4:102672851-102672873 TTTTTCTACAGATTGGGGGTGGG - Intronic
978704724 4:111692852-111692874 TTTTTCAACAGACGGGAGTTGGG - Intergenic
978754474 4:112287077-112287099 TTTTTCCACAGACTGGGGTTGGG + Intronic
978952055 4:114572705-114572727 TTTTTCCATGGACAGGGGCTAGG - Intergenic
979095638 4:116546622-116546644 TTTTTCCACAAACCAGGGGAAGG + Intergenic
979350310 4:119636706-119636728 TTTTTCCATGGACTGGGGTTGGG + Intergenic
979444371 4:120793483-120793505 TTTTTCCATGGACCAGTGTTGGG - Intronic
979598093 4:122556476-122556498 TTATTCCACAGACAGGGGGTTGG + Intergenic
979791011 4:124781127-124781149 TTTTTCCACAGACTGGCAGTGGG - Intergenic
979835816 4:125366069-125366091 TTGTTCCACAGAGCAGGGTGGGG - Intronic
979971347 4:127139728-127139750 TTTTTCCAAGGACAGGGGTCTGG + Intergenic
980016668 4:127657913-127657935 TTTTTCCACAGACCAGGGTTGGG - Intronic
980656562 4:135794437-135794459 TTTTTCCACAGACTGGAGTGGGG + Intergenic
981000147 4:139821485-139821507 TTTTTCCACAGACCAGGGGTCGG - Intronic
981088618 4:140709701-140709723 TTTTTCCATGGACCAGAGTTGGG + Intronic
981207122 4:142055800-142055822 TTTTTCCACTGACCTGGGGGTGG + Intronic
981305978 4:143247489-143247511 TTTTTCCAGGGACTGGGGGTGGG - Intergenic
981734740 4:147937071-147937093 TTTTTCCACCGATTGGGGTGGGG - Intronic
981786307 4:148483109-148483131 TTTTTCCACAGACTGGGGTGGGG - Intergenic
981961947 4:150551934-150551956 TTTTTCCACAGACCAAAGTGGGG + Intronic
981988719 4:150889674-150889696 TTTTTCCACAAACTGGGGTTGGG - Intronic
982086302 4:151840211-151840233 TTTTTCCACAGACTGGGGGTGGG - Intergenic
982484443 4:155950856-155950878 TTTTTCCACGGACTGGGGTGTGG - Intronic
982678591 4:158403632-158403654 TTTTTCCATGGACCAGGGTGGGG - Intronic
982713691 4:158784409-158784431 TTTTTCCACAGACAGTGGAGTGG + Intronic
982714814 4:158795899-158795921 TTTTTCCATGGACTGGGGGTGGG - Intronic
982896921 4:160942006-160942028 GTTTTCCACAGATGGGGGTGGGG + Intergenic
983139077 4:164125915-164125937 TTTTTCCACAGAATGGGGCAGGG - Intronic
983652607 4:170048561-170048583 TTTTTCCATGAACCGGGGTTGGG + Intergenic
984588670 4:181591786-181591808 TTTTTCCACAGACAGGAGTAGGG - Intergenic
984814286 4:183822327-183822349 TTTTTCCACAGACTGGCATGGGG + Intergenic
985110400 4:186541783-186541805 TTTTTCCACAGGACAGGGTGGGG - Intronic
985143860 4:186872633-186872655 TTTTTCCACAGACCAGGGTGGGG - Intergenic
985530013 5:428584-428606 TTTTTCCACAGACTGGGAGTGGG + Intronic
985648433 5:1096052-1096074 TTTTTCTAGAGACCGTGATTGGG + Intronic
986237126 5:5921770-5921792 TTTTTCCACCTACCTGGGATGGG - Intergenic
986837966 5:11662818-11662840 TTTTTCCATGGACGGGGTTTTGG - Intronic
986952109 5:13101329-13101351 TTTTTCCATGGACCAGGGTCAGG - Intergenic
987017897 5:13838741-13838763 TTTTTCTACAGACCAGGGGGTGG - Intronic
987018792 5:13848418-13848440 TTTTTCCATAGACCAGGGGTGGG + Intronic
987133279 5:14879012-14879034 TTTTTCCACAGACTGGGGGCAGG - Intergenic
987865332 5:23528711-23528733 TTTTTCCACTGGCTGGGGTCGGG + Intergenic
988095957 5:26610354-26610376 TTTTTCCACAGACCCAGGGTTGG - Intergenic
988144946 5:27293237-27293259 TTTGTCCATAGACCTGGGTGGGG - Intergenic
988805553 5:34737132-34737154 TTTTTCCATAGACCAGGGGCCGG - Intronic
988808160 5:34759762-34759784 TTTTTCCACAGACCAGGTACGGG - Intronic
989163573 5:38413806-38413828 TTTTTCCACGGACCAAAGTTGGG + Intronic
989225565 5:39024001-39024023 TTTTTCCATGGACCCGGGGTGGG + Intronic
989257177 5:39378433-39378455 GTTTTCTTCAGACCTGGGTTAGG + Intronic
989469154 5:41795058-41795080 TTTTTCCACAGACTGGGGGATGG + Intronic
989472488 5:41836559-41836581 TTTTTCCACAGATGGGGGTTGGG + Intronic
989552380 5:42751016-42751038 ATTTTCCACAGACTGGGATGGGG - Intergenic
989743441 5:44799058-44799080 TTTTTCCACGGACTGAGGTGGGG - Intergenic
989799095 5:45513741-45513763 TTTTTCCACAGTCAGGGGTGGGG - Intronic
990009685 5:50981971-50981993 TTTTTCTACAGACCAGGGAGAGG - Intergenic
990070802 5:51780751-51780773 TTTTTCCACAGATCTTGTTTTGG - Intergenic
990148070 5:52785411-52785433 TTTTTCCACAGACCAGGGGTAGG + Intergenic
990390493 5:55314766-55314788 TTTTTCCACAGACCAGCAGTAGG + Intronic
990443121 5:55866349-55866371 TTTTTCCATGGACAGGGGGTGGG + Intronic
990520099 5:56571413-56571435 TTTTTCCACGGACTAGGGTGGGG - Intronic
990568780 5:57056793-57056815 TTTTTCCACAGACCGGGTAGTGG - Intergenic
990612111 5:57468116-57468138 TTTTTCCACAGACTGGGGGGTGG + Intergenic
990650837 5:57897868-57897890 TTTTTCCACGGATGGAGGTTGGG + Intergenic
990972148 5:61519805-61519827 TTTTTCCACGGATGGGGGGTGGG + Intronic
991095028 5:62730966-62730988 TTTTTCCACAGACCTGGGGTGGG + Intergenic
991316144 5:65309092-65309114 CTTTTCCACAGACCAGGGTGGGG + Intronic
991448522 5:66726846-66726868 TTTTTCCACGGACTGGGGGTAGG - Intronic
991625241 5:68594298-68594320 TTTTTCCACAGATGGGGGTGGGG - Intergenic
991670075 5:69038397-69038419 TTTTTCCACAGATGGGGGGCAGG + Intergenic
991984954 5:72275761-72275783 TTTCCCCACTGGCCGGGGTTGGG + Intronic
992474655 5:77089502-77089524 TTTTTCCATGGACAGGGGTGGGG - Intergenic
993037265 5:82771423-82771445 TTTTTCCACAGACCAGGGACGGG + Intergenic
993078765 5:83269847-83269869 TTTTTCCATGGACCTGGGGTGGG + Intronic
993157177 5:84240669-84240691 TTTTTCCATGGACCGGTGGTTGG - Intronic
993498772 5:88639806-88639828 TGTTTCCACAGCCTTGGGTTTGG - Intergenic
993770543 5:91919274-91919296 TTTTTCCACAGACTGGGTGGGGG + Intergenic
993833347 5:92786958-92786980 TTTTTCAATGGACCGGGGATGGG + Intergenic
993840157 5:92867490-92867512 TTTTTCCACAGAACAGAGTTAGG - Intergenic
993855260 5:93066378-93066400 TTTTTCCACAGATGGGGGTTGGG - Intergenic
993954810 5:94219072-94219094 TTTTTCCACAGATGGGGGCGGGG + Intronic
994153417 5:96475187-96475209 TTTTTCCCCAGACTGGGATGAGG - Intergenic
994163557 5:96584111-96584133 TTTTTCCACAGACAAGGGGTGGG + Intronic
994198821 5:96949494-96949516 TTTTTCCACAGACAGGGGTGTGG - Intronic
994453484 5:99974341-99974363 TTTTTCAACAGACCAGGGTTGGG - Intergenic
995225187 5:109692775-109692797 TTTTTCCACAGACAGGGGTGGGG + Intronic
995354428 5:111222714-111222736 TTTTTCCACAGACAGGGGGTGGG - Intergenic
995463877 5:112430851-112430873 TTTTTCCACAGACTTGGGGGTGG + Intergenic
995548757 5:113258614-113258636 TTTTTCCACAGACAGTGGCAGGG - Intronic
995911769 5:117196292-117196314 TTTTTCCAGGGACTGGGGTAGGG + Intergenic
995952458 5:117732533-117732555 TTTTTCCATAGACTGGGGTGGGG + Intergenic
996309645 5:122090643-122090665 TTTTTCCATGGACCAAGGTTAGG + Intergenic
996322112 5:122230502-122230524 ATTTTCCACAGATTGGGGGTAGG + Intergenic
997052888 5:130403305-130403327 TTTTTCCACAGATAGGGTTGTGG - Intergenic
997272663 5:132554937-132554959 TTTTTCCACAGACAGGAGTGGGG + Intronic
997358441 5:133279404-133279426 TTTTTCCACAGACTGGGAGTGGG - Intronic
997693876 5:135846217-135846239 TTTTTCCAAAGACCAGGGTGGGG - Intronic
997839894 5:137229702-137229724 TTTTTCCACAGACCAGGAGGTGG + Intronic
998915793 5:147010285-147010307 TTTTTCCACAGACTGGGGCAGGG + Intronic
999193735 5:149767812-149767834 TTTTTCCACAGATGGGGTTGGGG + Intronic
999222389 5:149991255-149991277 TTTTTCCACTGACAGGTCTTGGG - Intronic
999587275 5:153103845-153103867 CTTTTCCACAGACTGGGGGATGG - Intergenic
1000078836 5:157824007-157824029 TTTTTGCACAGACCAGGGGTTGG - Intronic
1000387973 5:160693666-160693688 TTTTTCCATGGACAGTGGTTGGG + Intronic
1000814136 5:165899483-165899505 TTTTTCCACAGAACTGGGGAGGG - Intergenic
1000857061 5:166412122-166412144 TTTTTCCATAGACCGGGTGGAGG + Intergenic
1000913447 5:167050399-167050421 TTTTTTCACAGACTGGGGTTGGG - Intergenic
1001010682 5:168095176-168095198 TTGTTCTACAGACTGGGGCTTGG - Intronic
1001225391 5:169940419-169940441 TTTTTCCACAGACCGGGAGGAGG + Intronic
1001260783 5:170226817-170226839 TTTTATCAGAAACCGGGGTTGGG + Intergenic
1001350897 5:170963528-170963550 TTTTTCCATGGACCGGGGCAGGG + Intronic
1001468146 5:171987122-171987144 TTTTTCCACAGACCAGGCACGGG - Intronic
1002195642 5:177499558-177499580 TTTTTCCACAGACTGGGGGTGGG - Intergenic
1002765050 6:232225-232247 TTTTTCCACGGACTGGGGCAGGG + Intergenic
1002899851 6:1401396-1401418 TTTTTCCACAGACGGGGCAGAGG + Intergenic
1002949685 6:1797270-1797292 TTTTTCCACTGACTGGGGGGTGG - Intronic
1003714586 6:8632210-8632232 CCTTTCCACAGACAGGGGTGGGG + Intergenic
1004000182 6:11590827-11590849 TTTTTCCACCGAGTGGGGTGTGG + Intergenic
1004098568 6:12584755-12584777 CTTTTCCACTGAATGGGGTTGGG - Intergenic
1004121252 6:12824408-12824430 TTTTTCCACGGACCAGGGTAGGG - Intronic
1004157900 6:13186759-13186781 TTTTTCCACAGACCGGAGGTGGG + Intronic
1004373757 6:15074600-15074622 TTTTTCCACAGATGGAGGGTGGG + Intergenic
1004672477 6:17810516-17810538 CTTTTCCATGGACCGAGGTTGGG + Intronic
1004949761 6:20655695-20655717 TTTTTCCACAGACCGGGGGTGGG - Intronic
1005638929 6:27776330-27776352 TTTTTCCATGGACAGGGGTTGGG + Intergenic
1006507497 6:34498935-34498957 TTTTTCCACAGACTGGGGTTGGG + Intronic
1006507505 6:34498963-34498985 GTTTTCCACAGACCAGGGTTAGG + Intronic
1007401946 6:41607710-41607732 TTTTTCCATGGACCAGGGTGGGG + Intergenic
1008681620 6:53878267-53878289 TTTTTCCACAGACCAGTGTTGGG + Intronic
1008694140 6:54014415-54014437 TTTTTCCACAGATGGGGCTAGGG + Intronic
1008897227 6:56570223-56570245 TTTTTCCACAGGCCAGGGAGGGG + Intronic
1008909360 6:56716801-56716823 TTTTTCCACAGACCAGGGTCAGG + Intronic
1008967488 6:57327852-57327874 TTTTTCCACGGACTGAGGTCGGG + Intronic
1009052196 6:58289654-58289676 TTTTTCCACAGACTGGGGTTGGG + Intergenic
1009747433 6:67835553-67835575 TTTTCCCATAGACCTGAGTTTGG - Intergenic
1010155469 6:72787081-72787103 TATCTCCACAGACCAGGGTTTGG + Intronic
1011569915 6:88724547-88724569 TTTTTCCACAGACAGGGGAAGGG + Intronic
1011814529 6:91172991-91173013 TTTTTCCACAGAGGGTGGCTGGG + Intergenic
1011846163 6:91565700-91565722 TTTTTCCACGGACCAGGGTTGGG + Intergenic
1011934600 6:92759693-92759715 TTTTTCCACGGACTGGGGTTGGG - Intergenic
1012973438 6:105755337-105755359 TTTTTCCATAGACTGGGGGAGGG - Intergenic
1013331502 6:109106200-109106222 TTTTTCCACGGACCTGGGTTAGG - Intronic
1013333690 6:109133492-109133514 CTATTCCACAGACCAGGGGTTGG + Intronic
1013385490 6:109625680-109625702 TTTTTCCACAGACTGGGTTGTGG - Intronic
1013420911 6:109965947-109965969 TTTTTCCACAGACCAGAGACAGG - Intergenic
1013465819 6:110416039-110416061 TTTTTCCACAGACTGGGGATGGG + Intergenic
1013471988 6:110474184-110474206 TTTTTCCACAGACCTGTGGTGGG - Intronic
1013496230 6:110700342-110700364 TTTTTTCACATACCGGGGTTCGG - Intronic
1013586548 6:111583757-111583779 TTTTTCCATGGACTGGGGATGGG - Intronic
1013725373 6:113089017-113089039 TTTTTCCATGGGCCAGGGTTGGG + Intergenic
1014010437 6:116469414-116469436 TTTTTCCACAGACAGGGGTGGGG + Intergenic
1014102795 6:117530286-117530308 TTTTTCCACAGACGGGGTGGGGG + Intronic
1014191094 6:118497562-118497584 TTTCTCCACAGACCTGGGGAGGG - Intronic
1014227010 6:118860789-118860811 TTTTTCCACAGACCAGAGTGGGG + Intronic
1014335755 6:120134067-120134089 TTTTTCCACAGACCTGGGGTTGG + Intergenic
1014403171 6:121015862-121015884 TTGTTCCACAGAGTGGGGATGGG - Intergenic
1014516711 6:122387752-122387774 TTTTACCAGAGGCCGGGGTTGGG + Intergenic
1014527589 6:122519455-122519477 TTTTTCCACAGACGGAGGTGGGG - Intronic
1014540967 6:122675963-122675985 TTTTTCCACAGACTTGGGGTTGG + Intronic
1014592884 6:123294455-123294477 TTTTTCCACAGCCTGGGGTCGGG + Intronic
1014615309 6:123590847-123590869 TTTTTCCACAGGCCAGGGCAGGG - Intronic
1014712264 6:124820881-124820903 TTTTCCCATAGACCAGGGTTGGG - Intronic
1014744996 6:125190487-125190509 TTTTTCCACAGACGAAGGTTGGG + Intronic
1014830814 6:126100702-126100724 TTTTTCCACAGACAAGAGTCGGG + Intergenic
1015166915 6:130208813-130208835 TTTTTCCAAGGACAGGGGTCAGG - Intronic
1015230719 6:130912166-130912188 TTTTTCCACATACCGGGGTGGGG - Intronic
1015240868 6:131021930-131021952 TTTTTTCACAGACCAGGGCCGGG + Intronic
1015465583 6:133544778-133544800 TTTTTCCACAGATGGGGGCGGGG - Intergenic
1015761328 6:136664444-136664466 TTTTTCCATGGACCAGGGGTGGG - Intronic
1015832784 6:137387963-137387985 TTTTTCCACGGACCAGGGTGAGG - Intergenic
1015957629 6:138614930-138614952 TTTTCCCACAGACCTGGGGTAGG - Intronic
1016055272 6:139571875-139571897 TTTTTCCACGGACTTGGGGTCGG - Intergenic
1016441148 6:144084766-144084788 TTTTTCCATGAACCAGGGTTGGG - Intergenic
1016756984 6:147697951-147697973 TTTTTCCAGAGTCCTGGGGTGGG + Intronic
1017027257 6:150192305-150192327 TTTTTTCACAGACTGGGGGTTGG + Intronic
1017041258 6:150310161-150310183 TTTTTCCACGGACTGGGAGTCGG - Intergenic
1017547147 6:155464825-155464847 TTTTTCCACAGACTGAAGGTAGG + Intergenic
1017735546 6:157359662-157359684 TTTTTCCATAGACCAGGGTGCGG + Intergenic
1018489382 6:164276011-164276033 TTTTTCCACGGACCAGGGTAGGG - Intergenic
1018662285 6:166099294-166099316 TTTTTCCACGGACCAGGAGTGGG + Intergenic
1018891353 6:167985588-167985610 TTTGTCCACAGGCTGGGGGTAGG - Intergenic
1019949628 7:4360944-4360966 ATTTTCCACAGACAGGGGCAAGG + Intergenic
1019986278 7:4658553-4658575 TTTTTCCACAGACCAGAGTGGGG + Intergenic
1020826512 7:13035771-13035793 TTTTTCCACAAACTGGTGGTGGG - Intergenic
1020840890 7:13216187-13216209 TTTTTCCATGGACCAGGGATGGG - Intergenic
1021217162 7:17930969-17930991 TTTTTCCACGGACGGCTGTTGGG - Intronic
1021589458 7:22244704-22244726 TTTTTCTACGGACTGGGGTAGGG - Intronic
1021785435 7:24146803-24146825 TTTTTCCATGGACTGGGGTGTGG + Intergenic
1021877628 7:25063506-25063528 TTTTTCCATGGACCAGGGATGGG - Intergenic
1021885246 7:25131396-25131418 TTTTTCCATGGACCGGGGCATGG - Intergenic
1022746645 7:33179736-33179758 TTTTTCCACAGACCAGGAAGGGG - Intronic
1023049757 7:36240785-36240807 TTTTTCCGCAGACCTGGGTTGGG + Intronic
1023199699 7:37682991-37683013 TTTTTCCACAGACAGGGGTGGGG - Intergenic
1023425890 7:40035793-40035815 TTTTTCCATGGACTGGGGATGGG - Intronic
1023549150 7:41350334-41350356 TTATTCCACGGACCAGGGTAGGG - Intergenic
1023728769 7:43170357-43170379 TTTTTCCACAGACAGGGGTGGGG - Intronic
1023877238 7:44293552-44293574 TTTTTCCACAGACTGGGGCAAGG + Intronic
1024626628 7:51213446-51213468 TTTTTCCACAGACCAGGCTGGGG - Intronic
1025019126 7:55466951-55466973 TTTTTCCACGGACCAGGGGGTGG + Intronic
1025104906 7:56162807-56162829 TTTTTCCACGGATGGGGGTTGGG - Intergenic
1026225268 7:68434728-68434750 TTTTTCCACGGACTGGGGGTTGG + Intergenic
1026269007 7:68820216-68820238 TTTTTCCGAGGACCGGGGTTGGG + Intergenic
1026314052 7:69212476-69212498 TTTTTCCACAGATAAGGGGTGGG - Intergenic
1026373939 7:69731111-69731133 TTTTTATACAGACAGGGTTTCGG - Intronic
1026399010 7:69989986-69990008 TTTTCCCACAGACCTGGGGATGG - Intronic
1027173893 7:75891110-75891132 TTTTTCCACAGACAGGTATGGGG + Intergenic
1027201733 7:76068237-76068259 TTTTTGTAGAGACCGGGGTGGGG + Intergenic
1027398752 7:77786179-77786201 TTTTTCCACGGACAGGGGTTGGG + Intergenic
1027482724 7:78718778-78718800 TTTTTCCACGGACAGGGGTTGGG - Intronic
1027613555 7:80392805-80392827 TTTTTCCACGGATTGGGGTGGGG + Intronic
1028297147 7:89148001-89148023 TTTTTCCACAGACAGGGCAAGGG - Intronic
1028479811 7:91292459-91292481 TTTTTCCACAGATTGGGGTAGGG - Intergenic
1028653741 7:93178716-93178738 TTTTTCCACAAACCGGGGAGTGG + Intergenic
1028924178 7:96339714-96339736 TCTTTCCACAGACTGGGGCCAGG - Intergenic
1029015673 7:97313235-97313257 TTTTTCCACACACCAGGGGTGGG + Intergenic
1029197877 7:98819065-98819087 TTTTGCCATTGGCCGGGGTTGGG + Intergenic
1029347717 7:99990905-99990927 TTTTTCCACGGACTGGGGAGGGG - Intergenic
1030041688 7:105456949-105456971 TTTTTGTAGAGACGGGGGTTTGG - Exonic
1030199139 7:106884632-106884654 CTTTTCCACGGACAGGGGTGGGG + Intronic
1030661235 7:112221480-112221502 TTTTTCCACAGACTGGGTTTTGG + Intronic
1030743864 7:113141329-113141351 TTTTTCCAAGGACAGGGGTGGGG - Intergenic
1030812369 7:113989846-113989868 TTTTTTCACAAACCTGGGCTGGG - Intronic
1030845157 7:114400587-114400609 TGTTTCCACAGACAGGAGTCGGG + Intronic
1030939551 7:115629363-115629385 TTTTTTCACAGACCAGAGGTGGG - Intergenic
1030989135 7:116279339-116279361 TTTTACAACAGACCAGGGTCAGG - Intergenic
1031759402 7:125692744-125692766 TTTTTAAATGGACCGGGGTTGGG - Intergenic
1032116129 7:129118731-129118753 TTTTTCCACAGACCAGGGAGTGG - Intergenic
1032224846 7:130023171-130023193 TTTTTCCACGGACCACGGTTGGG - Intronic
1032645223 7:133816657-133816679 TGTTTCCACGGACAAGGGTTGGG + Intronic
1032707261 7:134432228-134432250 TTTTTCCACAGACCTGGCGGTGG + Intergenic
1032950607 7:136906787-136906809 TTTTTCTAGAAACCGGGGTTGGG + Intronic
1033250962 7:139758744-139758766 TTTTTCCATGGACTGGGGGTGGG - Intronic
1033857519 7:145582825-145582847 TTTTTTACCAGACCGGGGTGAGG - Intergenic
1034007696 7:147492108-147492130 TTTTTCTACAGACCAGGGTGGGG + Intronic
1034197072 7:149256177-149256199 GTTTTCCACAGACAGTGGTGGGG + Intergenic
1034316633 7:150139138-150139160 TTTTTCCATGGACCGGGGAGTGG - Intergenic
1034790231 7:153961544-153961566 TTTTTCCATGGACCGGGGAGTGG + Intronic
1034899278 7:154897504-154897526 TTTCTCCACAGAGCTGGGCTGGG + Intergenic
1035286176 7:157808717-157808739 TTTTTCCATGGACCAAGGTTGGG - Intronic
1035371646 7:158382946-158382968 TTTTTCCATGGACCATGGTTGGG - Intronic
1035539448 8:421277-421299 TTTTTCCACAGACTGGGGCGAGG - Intronic
1035986054 8:4433276-4433298 TTTTTCTACGGACCAGGGTGTGG - Intronic
1036382662 8:8247685-8247707 TTTTTCCACTTACCAGGGTGGGG - Intergenic
1036586232 8:10126428-10126450 TTTTTCCACAGACTGGGGGCAGG + Intronic
1036612088 8:10359037-10359059 TTTTTCCATAGACCTGGGGTGGG - Intronic
1037190403 8:16117951-16117973 TTTTTCCACAGACCAGGGATGGG - Intronic
1037259640 8:16993568-16993590 TTTTTCCACGGACCAGGATGGGG + Intronic
1037355917 8:18019373-18019395 TTTTTCCATGGACTGGGGTAAGG + Intronic
1037530358 8:19766836-19766858 TTTTTCCACGGGCAGGGGGTGGG - Intergenic
1037734914 8:21558037-21558059 TTTTTCCATGGACCAGGGTTAGG + Intergenic
1037953958 8:23038868-23038890 TTTTTCCACGGACTGGAGTTGGG + Intronic
1038191048 8:25321344-25321366 TTTTTCCAAGGACCAGGGGTGGG + Intronic
1038199054 8:25394915-25394937 TTTTTCCATGGACCTGGGGTGGG + Intronic
1039037361 8:33374206-33374228 TTTTTCCACAGACCGGTAGGTGG - Intronic
1039042043 8:33417406-33417428 TTTTTCCACAGACTGTGGGGCGG - Intronic
1039114200 8:34074073-34074095 TTTTTCCACAGACTGGGGGCAGG + Intergenic
1039250919 8:35663048-35663070 TTTTTCCACGGACCTGGGGTGGG - Intronic
1039618858 8:38978423-38978445 TTTTTCCACAGACGGAGGGGTGG - Intronic
1039960880 8:42246823-42246845 TTTTTCCACGGACCTGGGGTTGG + Intergenic
1040087509 8:43360823-43360845 TTTTTCCACAGACCTGAGGTGGG - Intergenic
1040546261 8:48400386-48400408 TTTTTCCACGGACAGTGGGTGGG - Intergenic
1040808466 8:51422311-51422333 TTTTTCCACTGACCGGGGTGGGG - Intronic
1040907452 8:52483281-52483303 TTTTTCCACAGACCAAGGGTGGG + Intergenic
1041225853 8:55697543-55697565 TTTTTCCACGGACAGGGGCGTGG + Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1041283505 8:56235977-56235999 TTTTTCCATGGACCAGGGTAGGG - Intergenic
1041303126 8:56433970-56433992 TTTTTCCATGGACCAGGGTGGGG + Intergenic
1041332967 8:56748385-56748407 CTTTTCCACAGACTGGGGGTAGG - Intergenic
1041450710 8:58004018-58004040 TTTTTCCACGGACTGGGGGATGG + Intronic
1041646534 8:60258517-60258539 TTTTTCCACAGACAGGGGGCAGG + Intronic
1041860216 8:62504226-62504248 TTTTTCCACAGACTGGTGGTGGG - Intronic
1042315751 8:67424307-67424329 TTATTCCACGGACAGGGGTGGGG - Intronic
1042318643 8:67451597-67451619 TTTTTCCACAGACTGGAGAGTGG - Intronic
1042378251 8:68081128-68081150 TTTTTCCACAGGCGGAGGGTGGG + Intronic
1043005580 8:74814353-74814375 TTTTTCCACAGACGAGGGAGGGG + Intronic
1043013635 8:74910952-74910974 TTTTTCCATGGACCAGGGTGGGG - Intergenic
1043268217 8:78293901-78293923 TTTTTACACAGACAGAGGTAAGG - Intergenic
1043531416 8:81155131-81155153 ACTTTCAACAGACCAGGGTTTGG + Intergenic
1043568636 8:81575916-81575938 TTTTTCCATACACAGGGGTTTGG - Intergenic
1043727661 8:83630422-83630444 TTTTTCCATGGACTGGGGTGGGG - Intergenic
1043781343 8:84339638-84339660 TTTTTCCACAAACTGGGGGGTGG - Intronic
1043866828 8:85384162-85384184 TTTTTCCACAGACCGACGTGGGG - Intronic
1044031727 8:87246776-87246798 TTTTTCCACGGACTAGGGGTGGG + Intronic
1044064954 8:87687946-87687968 CTTTTCCACAGATGGGGGTTGGG + Intergenic
1044172739 8:89075845-89075867 TTTTTCCATGGACTGGGGTTGGG - Intergenic
1044253309 8:90030015-90030037 TTTTTTCACAGACCAGGGGAAGG + Intronic
1044416417 8:91945187-91945209 TTTTTCCACAGACCAGGGTAGGG + Intergenic
1044866360 8:96574875-96574897 TTTTTCCACTGACCGAGGGCAGG + Intronic
1045001970 8:97886336-97886358 TTTTTCCACAGACCCAGCTGTGG - Intronic
1045174458 8:99706819-99706841 TTTTTCCACAGTCCTTGGGTTGG - Intronic
1045229784 8:100292964-100292986 TTTTTCCACAGATGGAGGTGGGG + Intronic
1045643772 8:104280742-104280764 TTTTTCCATAGACTGGGGCGTGG + Intergenic
1045654927 8:104376942-104376964 TTTTTCTACAGACCGGGGGTTGG + Intronic
1045842837 8:106599815-106599837 TTTTTCCAGGGACCTGGGGTAGG + Intronic
1045877530 8:106999735-106999757 TTTTTCCACAGACAGGGTGGGGG - Intergenic
1046037744 8:108864471-108864493 TTTTTCCACGGAGCTGGGGTAGG - Intergenic
1046349334 8:112985974-112985996 TTTTTCCACAGATCGGGGGTGGG - Intronic
1046461418 8:114542224-114542246 TTTTTCCACAGACAGGGCAGTGG + Intergenic
1046526671 8:115389676-115389698 TTTTTCCATGGACTGGGGTCAGG + Intergenic
1048071831 8:131029365-131029387 TTTTTCCACAGACATGGGTGGGG - Intronic
1048387663 8:133927631-133927653 TTTTTCCATGGACCCCGGTTTGG + Intergenic
1048480256 8:134783473-134783495 TTTTTCCATGGACAGGGGTAAGG - Intergenic
1048723793 8:137358717-137358739 TTTTTCCACAGACCAGGGTTAGG - Intergenic
1048779440 8:137985508-137985530 TTTTTCCACGGACTGGAGGTTGG - Intergenic
1051332123 9:16033690-16033712 TTTTTCCACAGACAGGGGGTGGG - Intronic
1051689605 9:19696236-19696258 TTTTTCCACAGACCGAGGTTGGG - Intronic
1051788622 9:20774142-20774164 TTTTTCCACACACCTGGGGCAGG - Intronic
1051849907 9:21494359-21494381 TTTTTCCATAGACCAGGGTGGGG + Intergenic
1052020815 9:23523346-23523368 TTATTCCAAGGACTGGGGTTGGG - Intergenic
1052189491 9:25642080-25642102 TTTTTCCACAAATGGGGGATGGG + Intergenic
1052390385 9:27872338-27872360 TTTTTCCATGGACCAGGGTGTGG + Intergenic
1052597750 9:30582301-30582323 TTTTTCCACACACAGAGGGTGGG + Intergenic
1052811402 9:33063793-33063815 TTTTTCCACAGATGGTGGTGGGG - Intronic
1053329029 9:37187260-37187282 TTTTTCCATGGACAGGGGTCGGG + Intronic
1053728556 9:41028636-41028658 TTTTTCCACAGACTCGGGGAGGG + Intergenic
1054978619 9:71177360-71177382 TTTTTCCATAGACCAGGGGTAGG - Intronic
1054981375 9:71210435-71210457 TTTTCCCACAGACCAGGGAGTGG - Intronic
1055127022 9:72730614-72730636 TTTTTCCATATACTGGGGCTGGG + Intronic
1055354956 9:75428294-75428316 TTTTTCCACAGACTGGGAGGGGG - Intergenic
1055687653 9:78794517-78794539 TTTTTCCATAGATCAGGGGTAGG + Intergenic
1055846376 9:80568554-80568576 TTTTTCCACAGACCAGGGTGGGG + Intergenic
1056325218 9:85472287-85472309 TTTTTCCACAGACCAGGGCAGGG - Intergenic
1057447457 9:95127399-95127421 TGTTTCCACAGACCGGGAGGGGG + Intronic
1057775859 9:98008887-98008909 TGTTTCCACAGCCTGGGGGTGGG - Intronic
1057804069 9:98208341-98208363 TTTTTCCATGGACTGGGGTAGGG + Intronic
1057973991 9:99584198-99584220 TTTTTCCACAGACCAGAATGTGG + Intergenic
1058014545 9:100015735-100015757 TTTTTCCACTGATCAGGGTGGGG + Intronic
1058068062 9:100571626-100571648 TTTTTCCATGGACTGGGGATTGG + Intronic
1058615101 9:106817872-106817894 TTTTTACACGGACCAGGGTGGGG + Intergenic
1058999282 9:110331635-110331657 TTTTTCCCCAGACTGGGGGTGGG + Intronic
1059017267 9:110532939-110532961 TTTTTCCACTGACTAGGGTACGG + Intronic
1059348039 9:113645584-113645606 TTTTTCCACAGACAGGAGATGGG - Intergenic
1059359916 9:113734228-113734250 TTTTTCCATGGACAGGGGGTTGG - Intergenic
1059996201 9:119912743-119912765 TTTTTCCACGGACCGGTGCAGGG + Intergenic
1060160855 9:121361829-121361851 TTTTTCCACAGGAAAGGGTTGGG + Intronic
1060345959 9:122815999-122816021 TTTTTCCACAGACTGGGGTTGGG + Intronic
1061467588 9:130794142-130794164 TTTTTCCACAGACTGGGGATGGG - Intronic
1062701833 9:137910420-137910442 TTTTTCCACAGACCAGAGGTCGG + Intronic
1185811120 X:3111617-3111639 TTTTTCTGCAGACTGGGGTGGGG + Intronic
1185834902 X:3336374-3336396 TTTTTCCACAGACAGGATTGTGG - Intronic
1185930868 X:4202126-4202148 TTTTTCCACGGACTGGTGGTGGG + Intergenic
1185983776 X:4807933-4807955 TTGTTCCACAGACCAGGGTTGGG + Intergenic
1186996708 X:15131399-15131421 TTTTTCCACAGACGGGGGGTGGG - Intergenic
1187386240 X:18851339-18851361 GTTTTCCACAGACTGGGGTGGGG - Intergenic
1187386250 X:18851367-18851389 TTTTTCCACAGACTGGGGTCGGG - Intergenic
1187460700 X:19484374-19484396 TTTTTCCACAGACCAGAGGTGGG - Intronic
1187724615 X:22189556-22189578 TTTTTTCAGAGACAGGGTTTCGG - Intronic
1187909120 X:24094081-24094103 TTTTTTCACAGATAGGGGGTGGG - Intergenic
1188034132 X:25297581-25297603 TTTTTCCACGGAGAGGGGTGGGG + Intergenic
1188065665 X:25656399-25656421 TTTTTCCACCGACCAAGGTTGGG + Intergenic
1188330042 X:28858898-28858920 TTTTTCCAAAGACCAGGCATAGG - Intronic
1188469182 X:30518108-30518130 TTTTTCCACAAACCAGAGTTGGG + Intergenic
1188674506 X:32922491-32922513 TTTTTTCACAGACTTGGGCTGGG + Intronic
1188700197 X:33250210-33250232 TTATTCCACAGACAGGGGTTTGG + Intronic
1188782862 X:34306983-34307005 AATTTCCTCAGACTGGGGTTGGG - Intergenic
1189114928 X:38332388-38332410 GTTTTCCACTGACAGGGGATGGG - Intronic
1189344195 X:40228152-40228174 TTTTTCCACAGACAGGGAGGTGG + Intergenic
1189453180 X:41158717-41158739 TTTTTCCACGGACTGGGGGGTGG + Intronic
1189642100 X:43084408-43084430 TTTTTCCACAGACCAGGGACGGG + Intergenic
1190068701 X:47261475-47261497 TTTTTCCATAGACCAGGGGTTGG + Intergenic
1190434795 X:50413110-50413132 TTTTTCCATGGACTGTGGTTGGG - Intronic
1191764411 X:64681826-64681848 TTTTTCCACAGACCAGGGAGAGG + Intergenic
1192224705 X:69220360-69220382 TTTTTCCACAGACCAGAGCCTGG + Intergenic
1192295397 X:69842456-69842478 TTTTTCCATGGACTGGGGTGGGG - Intronic
1192496661 X:71620741-71620763 TTTTTCCACGGACTGGAGTGGGG + Intergenic
1192548699 X:72036091-72036113 TTTTTCCACAGATGGGAGTCAGG - Intergenic
1193599603 X:83493982-83494004 TTTTTCCACAGACAGGTGCTGGG - Intergenic
1194945633 X:100063693-100063715 TTTTTCCACGGACCAGAGGTGGG - Intergenic
1195761281 X:108249161-108249183 TTTTACCACAGACCAGGGGTGGG - Intronic
1196786924 X:119428939-119428961 TTTTTCCACGGACAAGGGGTTGG - Intronic
1197549593 X:127873567-127873589 TTCTTCCACAGACCAGGGGGTGG + Intergenic
1197808839 X:130423154-130423176 TTTTTCCACAAATGGGGGTGGGG - Intergenic
1198271296 X:135058765-135058787 TTTTTCCAAGGATGGGGGTTGGG - Intergenic
1198558635 X:137824411-137824433 TTCTTCCACGGACCAGGGTGAGG + Intergenic
1200019501 X:153189872-153189894 TTTTTCCAAGGACTGGGGGTGGG - Intergenic
1200254183 X:154570665-154570687 GTTTTCCACAGACGGGGATGGGG + Intergenic
1200263586 X:154633743-154633765 GTTTTCCACAGACGGGGATGGGG - Intergenic
1200825298 Y:7632246-7632268 TTTTTCCACAGATCATGGGTGGG + Intergenic
1201052347 Y:9950370-9950392 TTTTTCCACAGACAAGAGGTGGG + Intergenic
1201241863 Y:11965120-11965142 TTTTTCCACAGACAGGGTTGGGG + Intergenic
1201332263 Y:12837292-12837314 TTTTTTCACAGACTGAGGATGGG + Intronic
1201436714 Y:13966669-13966691 TTTTTTCACAGACAGGGATGAGG - Intergenic
1202234758 Y:22698840-22698862 TTTTTCCACAGATCATGGGTGGG - Intergenic
1202308401 Y:23497328-23497350 TTTTTCCACAGATCATGGGTGGG + Intergenic
1202562400 Y:26173258-26173280 TTTTTCCACAGATCATGGGTGGG - Intergenic