ID: 1133911401

View in Genome Browser
Species Human (GRCh38)
Location 16:10069639-10069661
Sequence GCTCAAGTGTGTGCATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133911401_1133911402 6 Left 1133911401 16:10069639-10069661 CCATTAGATGCACACACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1133911402 16:10069668-10069690 AAGTACATCAAGCCCAGAACAGG 0: 1
1: 0
2: 1
3: 12
4: 124
1133911401_1133911403 7 Left 1133911401 16:10069639-10069661 CCATTAGATGCACACACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1133911403 16:10069669-10069691 AGTACATCAAGCCCAGAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 140
1133911401_1133911406 22 Left 1133911401 16:10069639-10069661 CCATTAGATGCACACACTTGAGC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1133911406 16:10069684-10069706 GAACAGGGAAAGATATTTCCAGG 0: 1
1: 0
2: 2
3: 18
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133911401 Original CRISPR GCTCAAGTGTGTGCATCTAA TGG (reversed) Intronic
903372628 1:22846778-22846800 GCTCAAGTGTTTGCACCTCCAGG + Intronic
905926005 1:41750439-41750461 GCTCCAGTGTGTGCATCATCTGG + Intronic
909100543 1:71342979-71343001 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
911254717 1:95620739-95620761 GCTCAAATATGGGCTTCTAAGGG + Intergenic
914318270 1:146534432-146534454 GCTCAAGTATGAGCAACTGAAGG + Intergenic
914496090 1:148198924-148198946 GCTCAAGTATGAGCAACTGAAGG - Intergenic
914913364 1:151803603-151803625 GGTCCAGTGTGTGGATCTGAGGG + Intronic
915972982 1:160367063-160367085 GCTCAGGTGTGTGTGTCTGAGGG + Exonic
920009312 1:202856315-202856337 ACTTAAGTGTGTGCATCTTTTGG + Intergenic
921693409 1:218179415-218179437 AATCACTTGTGTGCATCTAAAGG + Intergenic
922009988 1:221573747-221573769 GGTCAAGTGTGTGAATTTTAAGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063018865 10:2105741-2105763 GCTCAAGCGTGTGCATTAAGAGG - Intergenic
1063933989 10:11058282-11058304 GCCCTGGTGTGTGCTTCTAATGG + Intronic
1067164430 10:43853993-43854015 TCTCGAGTCTGTGCATCTGAAGG + Intergenic
1069245947 10:66206458-66206480 ACTCAAGTGTATGAATCTATGGG - Intronic
1070645167 10:78196709-78196731 GTTCAGGTCTGTTCATCTAATGG + Intergenic
1079049467 11:17140766-17140788 ACTGAATTGTGTGCATATAATGG + Intronic
1079069809 11:17334475-17334497 TCTCAAGTGAGTGAATCTGATGG + Intronic
1085229360 11:74951446-74951468 GCTCAAGTGTGTACTTGTTACGG + Intronic
1085831505 11:79906077-79906099 ACTCAAGTGTGTGCACTAAAAGG + Intergenic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1095965981 12:47867431-47867453 GCACAAGTGTGCACATTTAAGGG + Intronic
1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG + Intergenic
1098396890 12:70028824-70028846 GCTTAAGTGTGTGCCTCCTAGGG + Intergenic
1099438561 12:82672020-82672042 GTTCAATTGTGTGCATCTGGTGG + Intergenic
1101721250 12:107352542-107352564 GCACAAGAGTGTCCAACTAAGGG + Intronic
1102010655 12:109616461-109616483 AGTCAAGTGTGTGCATCATATGG + Intergenic
1105957314 13:25296091-25296113 GCATAAGTGTGTGCATATATGGG - Intergenic
1109018800 13:57057185-57057207 TCTCAAGTGTTTGCATATGAGGG + Intergenic
1112251814 13:97788323-97788345 GCTTAAGTGTGTGTATCACATGG + Intergenic
1113874074 13:113583830-113583852 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1113874080 13:113583870-113583892 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1113874086 13:113583910-113583932 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1113928219 13:113952748-113952770 GCTCAGGGCTGTGCATCTACAGG + Intergenic
1119153018 14:72382451-72382473 GCACAAGTGTGTGGAACAAAGGG + Intronic
1123489233 15:20766823-20766845 GTTCACGTGTGTGCATGCAATGG + Intergenic
1123545732 15:21335910-21335932 GTTCACGTGTGTGCATGCAATGG + Intergenic
1126742784 15:51794856-51794878 GCTCAAATGTGTGAAAATAATGG - Intronic
1127430594 15:58903524-58903546 GCTTAAGAATGTGCATCTGACGG + Intronic
1128005791 15:64239195-64239217 GTTGATGTTTGTGCATCTAATGG - Intronic
1130401741 15:83562261-83562283 GCTCCAGTATGTGCATGTCAGGG + Intronic
1130976973 15:88783872-88783894 GCTGCAGTTTGTGGATCTAAGGG - Intergenic
1202954074 15_KI270727v1_random:63181-63203 GTTCACGTGTGTGCATGCAATGG + Intergenic
1133911401 16:10069639-10069661 GCTCAAGTGTGTGCATCTAATGG - Intronic
1135344476 16:21676941-21676963 GCTGAAATATGTGCATCCAAAGG - Intergenic
1135405832 16:22197120-22197142 GTTCAAGTGTGGGCATCTTTAGG - Intergenic
1140314494 16:73881796-73881818 GTCCAAGAGTGTGTATCTAAAGG + Intergenic
1141385749 16:83621017-83621039 GCTCGAGGGCGTGCATATAAAGG - Intronic
1142682397 17:1557907-1557929 GATCAAGTGTGTGCATTTCTGGG - Intronic
1143142632 17:4750464-4750486 GCTGAAGTGGGTGGATCTCAAGG + Intergenic
1149334574 17:55622314-55622336 GGTCAAGTGCAAGCATCTAATGG - Intergenic
1155036746 18:22030847-22030869 GCTCAAGTGTTTCCTTCTCATGG + Intergenic
1156778092 18:40818379-40818401 GGTCAGGTGTGTTCCTCTAATGG - Intergenic
1160126390 18:76176269-76176291 GCTCAAATATGTGCAGCTGAAGG + Intergenic
1161250689 19:3278639-3278661 GCACATGTGTGTGCATCTGCAGG + Intronic
1162315203 19:9934612-9934634 TCTCAAGTGTGTGCCTCTTTTGG + Intronic
928386523 2:30873063-30873085 GCTCAAATGTCTGCTTCTTAAGG + Intergenic
929938143 2:46309932-46309954 GCTCTAGTGTGAGCATCAAGTGG + Intronic
932034483 2:68228762-68228784 TCTCAAATGTGTGCATTTAGTGG + Intronic
933005451 2:76987749-76987771 GCTCATGTTAGTGCATCTACAGG - Intronic
933947818 2:87302056-87302078 GCTCAAGTGTGTGCAAACAGAGG + Intergenic
935804044 2:106729133-106729155 GCTCAAGTGTGTGCCTCACACGG + Intergenic
936332381 2:111559516-111559538 GCTCAAGTGTGTGCAAACAGAGG - Intergenic
943902853 2:193463451-193463473 GCACAAACATGTGCATCTAAAGG - Intergenic
1169724811 20:8717063-8717085 TTTCAAGTTTGTACATCTAACGG - Intronic
1173464858 20:43272743-43272765 GCTAAAGTCTGTGCTGCTAATGG - Intergenic
1175636525 20:60588983-60589005 GCTCAAATGGTTGCATCTCACGG - Intergenic
1175851497 20:62096580-62096602 GCTCATGTGTGTGTATGCAAGGG - Intergenic
1176449106 21:6847736-6847758 GTTCACGTGTGTGCATGCAATGG - Intergenic
1176827274 21:13712760-13712782 GTTCACGTGTGTGCATGCAATGG - Intergenic
1178777499 21:35566109-35566131 GCTCAAGAGTGTGCAGCAATTGG - Intronic
1179396817 21:41047534-41047556 GCTCACGTGTGCCCACCTAAGGG + Intergenic
949768675 3:7554435-7554457 GCTCAACTGTAAGCTTCTAAGGG - Intronic
951802624 3:26613117-26613139 ACTCAAGTGCGATCATCTAAAGG - Intergenic
954535112 3:51354194-51354216 GATCAAGTGTGTGATTCTGAAGG - Intronic
956985422 3:74693850-74693872 GCTCAAGTGTCTGGAACTACAGG + Intergenic
959397994 3:105865906-105865928 GCTAAAGAGTGTGCATTTGAAGG - Intronic
959605585 3:108237644-108237666 GCTAATGTGTGTGCCTCTCACGG - Intergenic
964217578 3:154304011-154304033 GCTCAAATGTGTGCACATCATGG - Intronic
971544679 4:27870230-27870252 GCTCAAGTGTCTGCATTCAGAGG - Intergenic
979614684 4:122729186-122729208 GCTTAAGTGTGTGCATCATATGG - Intergenic
986269377 5:6217838-6217860 GCTTCAGTGTGTGCATCACATGG - Intergenic
990213171 5:53502454-53502476 GCTCAAGCATGTGCATTCAAAGG - Intergenic
1003803434 6:9698018-9698040 TGTCGAGTGTGTGCATGTAAAGG - Intronic
1004595172 6:17092849-17092871 ACACAAGTGTGTGCATCATAAGG + Intergenic
1009992437 6:70860632-70860654 GCTCTAATGTTTGCATATAAGGG + Exonic
1010266737 6:73876227-73876249 GCTTGAGTGTGTTCATCTCATGG + Intergenic
1011704158 6:89984545-89984567 ACACAAGTGTGTTCATCTACAGG + Intronic
1013646975 6:112154245-112154267 GCTGAAGTGTGCACATCCAAGGG - Intronic
1014658485 6:124136244-124136266 CCTCAAGATTGTGCATGTAAAGG - Intronic
1015327014 6:131934562-131934584 GCTGAAGTGGGTGCATCACAAGG + Intergenic
1016235405 6:141857786-141857808 GCTCAAGCATGTGCATTAAAAGG - Intergenic
1018667530 6:166152862-166152884 GCTGATGTGTGTGCAAATAATGG + Intergenic
1042684353 8:71421561-71421583 GCTCAAGTGTGTGTGTCTGGTGG + Intronic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1044820987 8:96155591-96155613 GTTCAAGTGTGTGCGTATGAGGG - Intronic
1050743240 9:8846709-8846731 GCTCAAGTGTGTGTGTGTTAGGG + Intronic
1051988274 9:23118355-23118377 CCTCAAGTGTCTTCATATAAAGG - Intergenic
1053410899 9:37915555-37915577 GCTCAAGGAGGTGCATTTAAAGG + Intronic
1058995912 9:110298642-110298664 GCTGAAGTGTGAGCATCTCAAGG + Intergenic
1061661984 9:132136382-132136404 GCCCAAGTGGGTGCTTCTGAGGG + Intergenic
1203520082 Un_GL000213v1:36780-36802 GTTCACGTGTGTGCATGCAATGG + Intergenic
1187981298 X:24760402-24760424 GCTCAAGTGTTTGAATCTGATGG + Intronic
1191154964 X:57264856-57264878 GCTAATGTGTGTGCCTCTCACGG + Intergenic
1192181728 X:68920449-68920471 GCTCCAGTGAGTGAAGCTAATGG - Intergenic
1193382926 X:80837333-80837355 TTTCAAGTTTGTGCATATAAAGG - Intergenic
1195589139 X:106603667-106603689 GGTCAAGGGTGTTAATCTAATGG - Intergenic
1195589562 X:106608889-106608911 ACACAACTGTGGGCATCTAATGG + Intergenic
1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG + Intergenic
1196371320 X:114982730-114982752 GCCCAAATGAGTACATCTAAGGG + Intergenic