ID: 1133911634

View in Genome Browser
Species Human (GRCh38)
Location 16:10071485-10071507
Sequence CAGTGTTATTAGGGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133911634_1133911637 13 Left 1133911634 16:10071485-10071507 CCTTCTTCACCCTAATAACACTG 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1133911637 16:10071521-10071543 TTCAAGTGCATTATGCCCCCAGG 0: 1
1: 0
2: 1
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133911634 Original CRISPR CAGTGTTATTAGGGTGAAGA AGG (reversed) Intronic
905059843 1:35130557-35130579 CAGTGTTAACAGGGTGTGGAAGG - Intergenic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
909081643 1:71119519-71119541 CAGTGTTATTATTGAGACGAAGG + Intergenic
909488040 1:76196145-76196167 AAGTGTTATTATTGTGAAAATGG + Intronic
911843520 1:102717033-102717055 GAGAGATATTAGGGTGAAGGTGG - Intergenic
912551413 1:110487847-110487869 CAGTGTGATAAGGGTGCAGCAGG + Intergenic
913306817 1:117436754-117436776 CAGTGTGATTGGGGTGGAGGTGG + Intronic
913556498 1:119972303-119972325 CTGTGTTATTAGGATGCAGGTGG + Intronic
915905485 1:159873770-159873792 CATTGTTATCAGGGAGAAGTAGG - Intronic
916744755 1:167676605-167676627 CAGTGTAATTTGGGAGATGATGG - Intronic
918251494 1:182707327-182707349 CAGTGTTCTTAGTGGGCAGAAGG - Intergenic
919524399 1:198629402-198629424 CAGAGTTTTTAAGGTGAAGAAGG + Intergenic
923816803 1:237389297-237389319 CAGAGTGATTAGGGGGAAAATGG + Intronic
924015268 1:239714468-239714490 CAGAGTTACTTGGGTGAGGAGGG + Intronic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
1063031064 10:2235339-2235361 CTGTGTTATGTGGGTGGAGATGG - Intergenic
1063819180 10:9814562-9814584 CAGTATTATGATGGTGAATAAGG + Intergenic
1063840021 10:10060808-10060830 CAGGGTTATGGGGGAGAAGAGGG + Intergenic
1066691952 10:38037967-38037989 CAGTGTTCATATGGTTAAGATGG - Intronic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068764527 10:60748333-60748355 CAGTTTTCTCAGGGTGAAGAGGG + Intergenic
1070071920 10:73098085-73098107 TATTGTTATTAGAGTGAAAAAGG - Intergenic
1071932403 10:90487139-90487161 CATTAATATAAGGGTGAAGAGGG - Intergenic
1075523749 10:123164411-123164433 CAATCTTATTAGGGTGCAGAAGG + Exonic
1076016861 10:127034839-127034861 CAGGGTCATAAGGGTTAAGAAGG - Intronic
1080026480 11:27620597-27620619 CAATGTTATTAGGCTGGATATGG + Intergenic
1081316271 11:41634656-41634678 CAGTTTTAATAGTGTGAATATGG + Intergenic
1086898822 11:92343238-92343260 CAGTATTATTATGATGAAAAAGG + Intergenic
1088467767 11:110159790-110159812 CAGTCCTTTGAGGGTGAAGATGG - Intronic
1088853618 11:113726203-113726225 CAGTGTTAGGGGGGTGAAGCGGG - Intergenic
1089838692 11:121394673-121394695 CAGTGTCATTTGGGTTAAGGTGG + Intergenic
1090846778 11:130536221-130536243 CAGTGCTATCAGGGTGAGAAGGG + Intergenic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1092656886 12:10695331-10695353 CACTGTTAAAAGGGTAAAGACGG + Intergenic
1097557406 12:61156290-61156312 GAGTGTTATTAGGGAGTAGCAGG - Intergenic
1101428931 12:104610807-104610829 CAGAGTAACTAGTGTGAAGATGG - Intronic
1101655569 12:106717132-106717154 CAGTGCTATTAGGGTGTGCAGGG - Intronic
1103690943 12:122774205-122774227 CACGGTTATTAGGGGGAAGATGG + Intergenic
1108000127 13:45898051-45898073 CAGTGTGATGAGGCTGAAGTAGG + Intergenic
1108816838 13:54303002-54303024 CAGTGTTTCTAGGGACAAGAAGG + Intergenic
1108985964 13:56587855-56587877 CAGTGTTAGTAGGGTGGAAAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112370835 13:98792011-98792033 CAGTGTTGTGAGGGGGAAGTAGG + Intergenic
1114375662 14:22144036-22144058 CAGTGTGATAAGGGTGGTGAGGG - Intergenic
1114803820 14:25810160-25810182 CAATCTTATTTTGGTGAAGATGG - Intergenic
1115839993 14:37459674-37459696 CTTTGCTATTAGGGTGATGATGG - Intronic
1121577853 14:95002938-95002960 CAGTGTTATGGCGGTGGAGAGGG + Intergenic
1124468672 15:29963631-29963653 CAGTGATCTTAGGGAGAAAAGGG - Intronic
1125305197 15:38304416-38304438 CTGTGGTATTACGGTGAATAGGG - Intronic
1126613466 15:50552941-50552963 CAATGTTGTTAGGGGAAAGAGGG - Intronic
1127293244 15:57588895-57588917 CAGAGATATAAGAGTGAAGAGGG + Intergenic
1130172399 15:81529134-81529156 CATTGTTCAAAGGGTGAAGATGG - Intergenic
1130709756 15:86268272-86268294 CAGTTTAATCAGGCTGAAGACGG + Intronic
1132170461 15:99647425-99647447 CAGTGTAGTTAGGGTTAAGGAGG - Intronic
1132356673 15:101176290-101176312 CTGTGTTATGTGGGTGGAGATGG - Exonic
1133911634 16:10071485-10071507 CAGTGTTATTAGGGTGAAGAAGG - Intronic
1134513994 16:14872136-14872158 TAGTATATTTAGGGTGAAGAAGG + Intronic
1134701636 16:16270635-16270657 TAGTATATTTAGGGTGAAGAAGG + Intronic
1134970194 16:18524015-18524037 TAGTATATTTAGGGTGAAGAAGG - Intronic
1138180645 16:54938227-54938249 CAGGGTTATTAGGGGAAAGGGGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140788083 16:78363027-78363049 CACTGTCATTAGGGAGCAGAAGG - Intronic
1140984354 16:80143530-80143552 CAGTGATATCAGGGAGAAAAAGG - Intergenic
1141226446 16:82120668-82120690 GAGTGGTATGAGGGTGAGGATGG + Intergenic
1141322784 16:83027412-83027434 AAGAGTTAACAGGGTGAAGAAGG + Intronic
1141495808 16:84408643-84408665 CCTTGATATTAGGGTAAAGAAGG - Intronic
1143461993 17:7109637-7109659 CAGTGCTGTCAGGGTGCAGATGG - Intronic
1143557944 17:7674192-7674214 CAGTGTGATGATGGTGAGGATGG + Exonic
1145048232 17:19636378-19636400 CAGTGTTATAAGGGTCAAGAGGG + Intergenic
1149392546 17:56206566-56206588 CAGTGTTATCTGGGTGAGAAGGG + Intronic
1152784096 17:82239114-82239136 CAGTGTTTTGAGGGGGAAGGTGG + Exonic
1153820895 18:8830474-8830496 CAGTGTCACTCGGGAGAAGATGG - Intronic
1155019780 18:21885432-21885454 CTTTGGTATTAGGGTGAAGCTGG + Intergenic
1155817777 18:30335385-30335407 CAGTATTATTTGGGTAAATAAGG + Intergenic
1157706510 18:49812523-49812545 CAGTGTAATTGGGGAGAAAAGGG - Intronic
1160251200 18:77204822-77204844 CATTGTTCTGAGGGTAAAGAGGG + Intergenic
1162594756 19:11619676-11619698 CAGTCATATTAGTGAGAAGAGGG + Intergenic
1168199375 19:54803954-54803976 CACTTGTATTGGGGTGAAGATGG - Intronic
928760981 2:34582675-34582697 TAGGTTTAATAGGGTGAAGAAGG - Intergenic
929961447 2:46499640-46499662 AAGTATTGCTAGGGTGAAGAGGG - Intronic
932176430 2:69607127-69607149 GAGTGTTATGTGGGGGAAGAGGG + Intronic
934016688 2:87893877-87893899 CAGTGTTACTGGTTTGAAGATGG + Intergenic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
940386339 2:153077455-153077477 AAGTGTTCATAGGGTGAATAAGG + Intergenic
940625325 2:156168313-156168335 TAGTGTTCTTGGGGTCAAGAAGG - Intergenic
941400620 2:165026164-165026186 AAGGGTTATTAGGCAGAAGAAGG + Intergenic
941659751 2:168183709-168183731 CAGTGAGATTAGGGAGAGGAAGG - Intronic
944088435 2:195876169-195876191 AAGTGTGATTAGGGTGAGAAGGG + Intronic
945097647 2:206234696-206234718 CAGAGTTATGAGAGTAAAGAAGG - Intergenic
945666243 2:212747173-212747195 CAGTGATATTATAGTGCAGAAGG - Intergenic
945759330 2:213893892-213893914 CAGTGTTATTACTGTAAATAAGG - Intronic
948860729 2:240751486-240751508 CAGGGGTATTAGGGTGTGGAGGG - Intronic
1169753258 20:9017064-9017086 CAGAGTTATAAGTGTTAAGATGG + Intergenic
1171165626 20:22967675-22967697 CAGCTGTAGTAGGGTGAAGAGGG - Intergenic
1171794393 20:29555157-29555179 TAGTGTTATTAAGGGCAAGAAGG - Intergenic
1172164391 20:32890107-32890129 CAGTGTTCTTAGGATGGAGGTGG + Intronic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1174966125 20:55217575-55217597 CTCTGTTAGTAGGATGAAGATGG + Intergenic
1178513349 21:33226021-33226043 CAATGTTATAAGGGTTGAGAGGG - Intergenic
1183072902 22:35408655-35408677 CAGGGTGAGTAGGGTGGAGAAGG + Intronic
1184997643 22:48221482-48221504 AAGTGTTATACAGGTGAAGAGGG + Intergenic
949628125 3:5891088-5891110 CAGAGGAATTAGGATGAAGATGG - Intergenic
949992227 3:9588927-9588949 CACTGTTAATAGAGTGAAAAGGG - Intergenic
953031061 3:39180335-39180357 CAGTGTGACTAGGGTGATGTGGG + Intergenic
954733031 3:52681395-52681417 CAGTATTATTAGTTTGAAGTTGG + Intronic
955055917 3:55456164-55456186 AAGTGATTTCAGGGTGAAGAGGG + Intergenic
955119223 3:56039076-56039098 GAGTGGTATGAGGGTGAGGATGG - Intronic
956268283 3:67422968-67422990 CAAATTTATTAGGCTGAAGAAGG + Intronic
957388530 3:79530822-79530844 CAGTGTTCTTAGAATAAAGATGG + Intronic
959408770 3:105995104-105995126 CAGGGTAATTAGGCTGGAGAAGG + Intergenic
961961012 3:130855109-130855131 CAGGATTAGAAGGGTGAAGATGG - Intronic
967266072 3:187693397-187693419 CATTGTTCTTAGGGGGAGGAAGG + Intergenic
971987810 4:33849130-33849152 CATTGATATTAGGGTGATGCTGG - Intergenic
972317146 4:37937316-37937338 CCGTCTTCTTAGGGAGAAGATGG - Intronic
972835695 4:42867406-42867428 AAGTGTTATTAATGTGTAGATGG + Intergenic
973053428 4:45624131-45624153 AAGAGTTATTATGCTGAAGATGG + Intergenic
973222351 4:47742959-47742981 CAGTGATATTACAGTGCAGAGGG + Intronic
974160641 4:58133651-58133673 CAGTGTTCTTATTTTGAAGATGG + Intergenic
974453614 4:62097326-62097348 CTGTCTTATTAGGGAGGAGATGG + Intergenic
979040300 4:115782769-115782791 CAGCATTCTTAAGGTGAAGATGG - Intergenic
980449879 4:132957495-132957517 CAGTGTGACTGTGGTGAAGATGG + Intergenic
980849863 4:138367875-138367897 CATTTTTATTGGGGTGAAGAAGG - Intergenic
982187425 4:152816970-152816992 CAGTGTTGTGAGCATGAAGAGGG - Intronic
984106050 4:175547448-175547470 CAGTTTTATTAGTGTGGTGAAGG - Intergenic
984825876 4:183924307-183924329 CAGTGGGATGAGGGTGATGATGG + Intronic
984919160 4:184748823-184748845 CAGTGTTCTTCAGGTGCAGAGGG - Intergenic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
989866665 5:46520184-46520206 CAGTGATTTGAGGCTGAAGAAGG + Intergenic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
998280888 5:140806625-140806647 CAGAAATACTAGGGTGAAGAGGG + Intronic
999727724 5:154450658-154450680 CAGTGTCAGTTGGGTGATGATGG - Intronic
1000513855 5:162216285-162216307 TAGTGTAAAGAGGGTGAAGAGGG - Intergenic
1003517107 6:6826596-6826618 CAGTGTCATAAGGCTGTAGATGG + Intergenic
1003635581 6:7828796-7828818 CGGTGTTGTTGAGGTGAAGAGGG + Intronic
1005440123 6:25858338-25858360 CAGTGTTTTGAGAGTGAAAATGG - Intronic
1008382313 6:50849355-50849377 CAGTGTTAGCAGGCTGTAGAGGG + Intergenic
1010823338 6:80442864-80442886 GAGTGTGATTAGGCAGAAGAAGG + Intergenic
1011491406 6:87897138-87897160 CAGAGAAATTAGGGTAAAGAGGG + Intergenic
1015101851 6:129490844-129490866 CACTGTTAAGGGGGTGAAGAAGG - Intronic
1015753231 6:136582100-136582122 CATTCTTATTAGGTGGAAGAGGG + Intronic
1016843923 6:148552504-148552526 CATTTTTAATAGGGAGAAGAGGG + Intergenic
1018666993 6:166147920-166147942 CACTGCTATTAGGGTGATCACGG - Intergenic
1019134710 6:169900767-169900789 CAGTGATGTTGGGGTGATGATGG + Intergenic
1019134717 6:169900801-169900823 CAGTGATGTTGGGGTGATGATGG + Intergenic
1019134919 6:169902049-169902071 CAGTGATATTGGGGTGATGATGG + Intergenic
1019134939 6:169902140-169902162 CAGTGATATTGGGGTGATGATGG + Intergenic
1019134951 6:169902202-169902224 CAGTGATGTTGGGGTGATGATGG + Intergenic
1021832390 7:24628315-24628337 GAGTGTTTTTAGCATGAAGAGGG - Intronic
1024959671 7:54960878-54960900 CAGTATTGTTAGGGTCAAGGAGG - Intergenic
1025171086 7:56757268-56757290 CAGTGATATTAGGATTGAGATGG - Intergenic
1025274036 7:57558493-57558515 CATTGATATTAGGGTGACGCTGG - Intergenic
1025700790 7:63818421-63818443 CAGTGAGATTAGGGTTGAGATGG + Intergenic
1026637207 7:72094645-72094667 CAGTGTTAATAAGATGGAGATGG + Intronic
1027367708 7:77475225-77475247 GAGTGTTGTGGGGGTGAAGAAGG + Intergenic
1027657227 7:80945489-80945511 AGGTGTTACTAAGGTGAAGAGGG + Intergenic
1028706185 7:93849599-93849621 CAGTTTTAGGAGAGTGAAGAGGG + Intronic
1028909418 7:96191041-96191063 TATTATTATTAGGGTGAAGAAGG - Intronic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1037202455 8:16274186-16274208 CAGTGTTATAAAGGACAAGAAGG + Intronic
1038379504 8:27079325-27079347 GAGTGTTCGGAGGGTGAAGAAGG - Intergenic
1038546212 8:28427504-28427526 CAGAGTTAAGAGGGTGAAGAAGG - Intronic
1038795790 8:30708122-30708144 CAGTGTTATTAAGGAAAAGCGGG - Exonic
1038909251 8:31943668-31943690 CAGTATTAAAAGGGTGAACAAGG - Intronic
1039100701 8:33939075-33939097 CACTGTAATTAGCTTGAAGAAGG - Intergenic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039818997 8:41119607-41119629 CAGTGTTATTGATGTGAAGGTGG - Intergenic
1042469706 8:69171404-69171426 CATTGGTATCAGGGTAAAGATGG + Intergenic
1043078815 8:75738192-75738214 CAATGTTGGTAGGGTGAGGAGGG + Intergenic
1045046154 8:98280945-98280967 CAGTGAAATTAAGGAGAAGATGG + Intronic
1045593402 8:103625102-103625124 CAGTGTTTTTAGGGGGAAGGAGG + Intronic
1046158557 8:110328555-110328577 CAGTTTTAGTAGGGAGAAAAGGG - Intergenic
1046170612 8:110500416-110500438 CAGTGTTATTAGGTTTGATAGGG - Intergenic
1047100633 8:121671798-121671820 CAGTGTAATTCGGGACAAGAAGG + Intergenic
1049226152 8:141451470-141451492 CAGTGTCATTGGGGTGGAGTGGG + Intergenic
1049967503 9:792599-792621 CAGCGTTGTTAGGTTGAAGCGGG + Intergenic
1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG + Intronic
1055184752 9:73437438-73437460 CAGTTATCTTAGGGTGAATATGG + Intergenic
1059446361 9:114340669-114340691 CAGTGCTACTAGGGGGCAGATGG + Intronic
1059889310 9:118783688-118783710 CATTTTTCTTAGGGTGAAGGGGG + Intergenic
1203409258 Un_KI270538v1:86805-86827 CAGTGATTTGAGGCTGAAGAAGG - Intergenic
1187160997 X:16765032-16765054 CAGTTTTATTGTGGGGAAGATGG + Exonic
1187324896 X:18277813-18277835 CAGTGTAATAGGGGAGAAGATGG + Intronic
1188122325 X:26323089-26323111 CAGTGTTATAAGGGATGAGAGGG + Intergenic
1188822636 X:34794382-34794404 CAGTGTTGTGAGGGTGACAATGG + Intergenic
1188907976 X:35810987-35811009 CAGTGTTATTAGGTAAAAGATGG + Intergenic
1192327258 X:70143339-70143361 CAGAGATTTTATGGTGAAGAGGG + Intronic
1194110947 X:89834254-89834276 CAGATTTTTTAGTGTGAAGAGGG + Intergenic
1194784843 X:98070059-98070081 CAGTCTTTTTAGTGTGAATAAGG + Intergenic
1196795173 X:119496361-119496383 CAATGTGATTAGGGTCATGAGGG - Intergenic
1198228272 X:134666506-134666528 CAGTCTTAGGAGGGTGAACATGG + Intronic
1199127798 X:144144663-144144685 CAGTGTTACTGGTTTGAAGATGG - Intergenic
1200463606 Y:3489000-3489022 CAGATTTTTTAGTGTGAAGAGGG + Intergenic
1202106355 Y:21371656-21371678 AAGTACTATTAGGGTGAATAAGG + Intergenic