ID: 1133914824

View in Genome Browser
Species Human (GRCh38)
Location 16:10100066-10100088
Sequence GGCCCATGTCAGACAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133914824 Original CRISPR GGCCCATGTCAGACAGGTGA AGG Intronic
900515955 1:3082343-3082365 GGCCAATGTCAGAGGGGTAACGG + Intronic
901188618 1:7390413-7390435 GGGACATGTCAGACAAGTAATGG - Intronic
903154700 1:21435850-21435872 GCCCCAGGTCACACAGTTGATGG - Intergenic
903655715 1:24947817-24947839 GGCCCCTGTCTGCCAGGCGAGGG + Intronic
904033374 1:27546855-27546877 GCCCTGTGTGAGACAGGTGAAGG - Intronic
905905593 1:41616158-41616180 AGTCCATTTCAGACAGGTCATGG + Intronic
910283080 1:85523084-85523106 TGACCATCTCAGACAGGTGTTGG - Intronic
910460045 1:87438832-87438854 GCCCAAAGTCAGAGAGGTGATGG - Intergenic
914206934 1:145539905-145539927 TGACCATCTCAGACAGGTGTTGG + Intergenic
914317266 1:146525087-146525109 GCCCAAAGTCAGAGAGGTGATGG - Intergenic
914435062 1:147652442-147652464 TGCCCAAGGAAGACAGGTGAGGG - Exonic
914497090 1:148208273-148208295 GCCCAAAGTCAGAGAGGTGATGG + Intergenic
917193850 1:172446363-172446385 GGCCCATGACAGTCAGATGAGGG + Intronic
917928413 1:179807500-179807522 GGCACATGTCTGGGAGGTGACGG - Intronic
919485768 1:198145495-198145517 CCCCCATGTCACAAAGGTGAAGG + Intergenic
920706033 1:208251205-208251227 GCCTCAAGCCAGACAGGTGAAGG + Intergenic
921195390 1:212751966-212751988 GGTCCATGCCACACAGGAGATGG + Intronic
921888096 1:220326572-220326594 GGTCCAAGTCTGACAGGTGAGGG + Intergenic
922597003 1:226821768-226821790 GGCCCATCTAGGAGAGGTGAGGG - Intergenic
924182597 1:241454134-241454156 GGCCCATGATAGACAGGTCTTGG - Intergenic
1062790147 10:298489-298511 AGCCCATGCCAGAGAGGAGAGGG + Intronic
1063197951 10:3760382-3760404 TGCCCATGTCAGGCAGAGGATGG + Intergenic
1067385247 10:45812738-45812760 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067449776 10:46375214-46375236 GTCCACTGTCAGACCGGTGATGG - Intergenic
1067587475 10:47484550-47484572 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067634531 10:47992316-47992338 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067634720 10:47993650-47993672 GTCCACTGTCAGACCGGTGATGG + Intergenic
1069123661 10:64602262-64602284 GGCACAGGTTAGAAAGGTGAGGG + Intergenic
1070141343 10:73740630-73740652 GTCCACTGTCAGACCGGTGATGG + Intergenic
1071259627 10:83908300-83908322 GGTCCAGCTCACACAGGTGAAGG - Intergenic
1071610515 10:87027365-87027387 GTCCACTGTCAGACCGGTGATGG - Intergenic
1075545063 10:123348892-123348914 GGCCCATCTGAGACAGCAGAGGG - Intergenic
1076443925 10:130499173-130499195 GGCCCAGGTCAGGCAAGTGCTGG + Intergenic
1077317561 11:1926131-1926153 GCCCCAGGACAGACAGGGGATGG + Intronic
1079347399 11:19664964-19664986 TGCTCATGTCACACAGCTGATGG + Intronic
1084569759 11:69952145-69952167 GGGTCAGGTCAGGCAGGTGAAGG + Intergenic
1085407980 11:76275454-76275476 GCTCCAAGTCAGACAGGCGAGGG - Intergenic
1086088815 11:82984362-82984384 GGCTCATGTCAAACAGATGGAGG - Intronic
1089620470 11:119719349-119719371 GGCGGGTGGCAGACAGGTGATGG - Intronic
1091558393 12:1593307-1593329 TGCCCATGTGCGACAGGTGCAGG + Exonic
1092560458 12:9607833-9607855 GGTCCATGGCAGACAGAGGAAGG + Exonic
1092766029 12:11853814-11853836 GGTCCATGACAGCCAGGTGCAGG + Intronic
1093490494 12:19699498-19699520 CTCCCATGTCAGACAGCAGAAGG - Intronic
1103376696 12:120462007-120462029 GGCCCTACTGAGACAGGTGATGG - Exonic
1105690923 13:22838391-22838413 GGCCCATGACAACCAGGGGAGGG + Intergenic
1109136442 13:58656989-58657011 GGCATATGTAAAACAGGTGAAGG + Intergenic
1109283557 13:60385409-60385431 CTCCCATGTCTGGCAGGTGATGG + Intergenic
1110133807 13:72040701-72040723 GGCCCAGGTTTGCCAGGTGAAGG - Intergenic
1110281159 13:73695818-73695840 GGTCTGGGTCAGACAGGTGATGG + Intronic
1111978929 13:94996843-94996865 GGCCCATGTGAGACAATGGATGG + Intergenic
1113065392 13:106368912-106368934 GGCCCCTCCCAGAGAGGTGAAGG + Intergenic
1113973811 13:114211468-114211490 CGCCCATGGGAGAGAGGTGAGGG - Intergenic
1114686029 14:24532510-24532532 GGGCCATTTCAGACAGAAGAAGG - Intergenic
1118601541 14:67473950-67473972 GGCGCAAGAGAGACAGGTGAGGG + Intronic
1120443702 14:84567219-84567241 GGCCCTTCTCAAACAAGTGAGGG + Intergenic
1121309797 14:92929524-92929546 GGCCCAGCTGAGAGAGGTGAGGG + Intronic
1121638323 14:95468609-95468631 GGGCCATCTCAGACAGCTGTGGG - Intronic
1121956069 14:98214644-98214666 GGCAGGTGTCAGAAAGGTGAGGG - Intergenic
1124096169 15:26650659-26650681 GGCACATGTAAAATAGGTGAAGG - Intronic
1124238901 15:28013924-28013946 GGTCCTTGTTAGACAGGTGAGGG + Intronic
1128867879 15:71129055-71129077 GGCCCAAGGCATACAGGAGAGGG + Intronic
1129416999 15:75389645-75389667 GAGCATTGTCAGACAGGTGAGGG - Exonic
1129999122 15:80032144-80032166 GGCCCACGTCAAACAGGGGATGG + Intergenic
1130302628 15:82691711-82691733 GGCCCTACTGAGACAGGTGATGG - Intronic
1130308992 15:82736184-82736206 GGCACATCTCAGACAGCAGAGGG + Intergenic
1133914824 16:10100066-10100088 GGCCCATGTCAGACAGGTGAAGG + Intronic
1134793577 16:17013636-17013658 GGCCCGTGTCAGACAAGTCATGG + Intergenic
1135621604 16:23960627-23960649 GGGCCATGTCAGAGTGGGGAGGG - Intronic
1136884439 16:33922971-33922993 GGCCGATGAAAGCCAGGTGAGGG - Intergenic
1137705840 16:50535317-50535339 GGCTCATGTAAGCCAGGTGTTGG - Intergenic
1138231773 16:55342938-55342960 GGCATATGTCAGAAAGGTGAGGG - Intergenic
1140092505 16:71849949-71849971 GTCCACTGTCAGACCGGTGATGG - Exonic
1142114357 16:88348604-88348626 GGACCGGGTCAAACAGGTGAGGG + Intergenic
1142568982 17:859973-859995 GGCCCAGGGCAGAGAGGTGTGGG + Intronic
1148850019 17:50550100-50550122 GGACCATGTGGGGCAGGTGACGG + Exonic
1151219890 17:72604598-72604620 GGGACATGTCAGCCAGGTGGAGG - Intergenic
1152130740 17:78474876-78474898 GGCCCATGTGACTGAGGTGAAGG - Intronic
1155489365 18:26384448-26384470 TGGCCATTTCAGACATGTGACGG - Intronic
1160579775 18:79876886-79876908 GGCTCATTTCAGCCAGGGGAGGG + Intronic
1161987269 19:7662887-7662909 GGCCCTTGTCAGTCAGGGAAAGG - Intergenic
1163631557 19:18420214-18420236 GGGCCAGGGCAGACAGGTGGCGG - Intronic
1164052372 19:21594282-21594304 GGGCCATGCCAGATAGTTGATGG - Intergenic
1165374850 19:35434476-35434498 GGCCCATCTCTGACAGCTCAGGG + Intergenic
1165740032 19:38199479-38199501 GCCCCATGTGAGAAAGCTGAGGG + Intronic
925750865 2:7089967-7089989 GGCCCCTGTCAGAGAGCGGAGGG - Intergenic
928158110 2:28894880-28894902 CGCCCAGGCCAGACAGGTGCAGG - Exonic
929018327 2:37524650-37524672 AGCCCATGCCAGCCAGGTGGGGG + Intergenic
929244862 2:39690262-39690284 GGCACATGACAGCCAGTTGAGGG - Intronic
937243142 2:120475423-120475445 GCCCCAGGTCACACAGCTGATGG + Intergenic
937969236 2:127536614-127536636 GGCCCAGGTCAGACAGCTGGTGG + Intronic
937996374 2:127697753-127697775 GGGCCATGACAGACAGGGAAGGG + Intergenic
938083163 2:128380954-128380976 GCCCCAGTTCAGACAGGTCAGGG + Intergenic
944495247 2:200300905-200300927 GGCCAATGTCAAGCAGTTGAGGG - Intergenic
948041136 2:234902528-234902550 GCCCCATGCCTGGCAGGTGATGG + Intergenic
1171372947 20:24673451-24673473 AGCCCAAGTCAGCCAGGTCATGG + Intergenic
1172922754 20:38499660-38499682 GCCTAAGGTCAGACAGGTGAAGG - Intronic
1175691016 20:61066080-61066102 GGCCTGTGTCACACAGGTGTGGG - Intergenic
1178861668 21:36295161-36295183 GGCCCTACTGAGACAGGTGATGG - Intergenic
1178977360 21:37231486-37231508 GGAGCCTTTCAGACAGGTGAGGG - Intronic
1182436374 22:30333139-30333161 GGCAAATGTCAGACAGGATAAGG + Exonic
1182554648 22:31122715-31122737 GGCCTACGGCAGAAAGGTGAAGG + Intronic
1182881219 22:33735164-33735186 GGCCCTTCTCAGCCAGGAGAAGG + Intronic
1183408591 22:37642219-37642241 GCCCCAGGTCACACAGGTGGAGG - Intronic
1184189855 22:42887422-42887444 GGCCCCTGTCAGTTAGGTGGTGG - Intronic
950129792 3:10534183-10534205 GACCCAGGTCAGAAAGGAGAAGG + Intronic
950723159 3:14898918-14898940 TGACCATGTCAGGCAGGTGTTGG + Intronic
951402933 3:22257003-22257025 GGCACATGTCAGTCAGAAGAAGG + Intronic
952165735 3:30746560-30746582 GCACCAGGTGAGACAGGTGATGG + Intronic
953909698 3:46885609-46885631 GGCCCATGTCTGAGAGTAGAAGG + Intronic
954955986 3:54518496-54518518 GGCCCAGGTCACACAGGTGCTGG - Intronic
957279315 3:78129265-78129287 AGACCATATCAGACAGGTCAAGG - Intergenic
960210212 3:114955715-114955737 AGCCAAAGTCAGAGAGGTGATGG - Intronic
969276275 4:6137878-6137900 GGCCCATGCCAGGAAGGAGAAGG - Intronic
969300511 4:6294446-6294468 GGCCCATGGCAGACACTTGTTGG + Intronic
979318985 4:119300864-119300886 GGCCCAGTCCAGTCAGGTGATGG + Intronic
982147800 4:152416873-152416895 AGCCCATATCACACAGGTGGTGG - Intronic
982560460 4:156923227-156923249 GGACCAGGTCAGCCTGGTGAAGG - Intronic
987400482 5:17470485-17470507 GGCCCTGGTGAGCCAGGTGATGG + Intergenic
988088801 5:26508218-26508240 GGCATATGTAAAACAGGTGAAGG - Intergenic
990584904 5:57201336-57201358 TGCCCATGCCACACAGGAGATGG + Intronic
990876776 5:60494886-60494908 GGCCCATTTCTGAGAGGGGAAGG - Intronic
992847839 5:80771699-80771721 GCCCCATGTGAGCCACGTGATGG + Intronic
995297536 5:110538575-110538597 GGCCCCTGTCAAAAATGTGAGGG + Intronic
996134412 5:119821514-119821536 TGACCATGTTAGACAGGAGAGGG + Intergenic
998375728 5:141689329-141689351 GACCCATGGGAGACAGGTCATGG - Intergenic
998499605 5:142621020-142621042 AGCCCAGGTGAGACAGGTGCTGG - Intronic
999841516 5:155432642-155432664 GGCCCATAGCAGGCAGGTGGAGG + Intergenic
1001162677 5:169335452-169335474 GACCCATTTAACACAGGTGATGG + Intergenic
1001771053 5:174296110-174296132 GCCCAAGGTCAGACAGGTGGTGG + Intergenic
1002592427 5:180299946-180299968 AGCCCCTGTGATACAGGTGAGGG + Intergenic
1002592441 5:180300016-180300038 AGCCCCTGTGATACAGGTGAGGG + Intergenic
1002592456 5:180300086-180300108 AGCCCCTGTGATACAGGTGAGGG + Intergenic
1002841603 6:911497-911519 GGCCCCCTACAGACAGGTGAGGG + Intergenic
1003201337 6:3964136-3964158 GGGCCATATCAGACAGATAAAGG + Intergenic
1007086103 6:39146767-39146789 AGCCCTTGTAAGACAGGGGATGG + Intergenic
1007373511 6:41442027-41442049 GGCCCTTGTCTGACTGGTCAAGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1015252420 6:131141299-131141321 GGACCATGACAGAGAGGTGGAGG - Intronic
1017875388 6:158520009-158520031 GGCCCAGGTCAGGCAGCAGAGGG - Intergenic
1018529534 6:164748006-164748028 GGCATATGTAAAACAGGTGAAGG + Intergenic
1019417034 7:932544-932566 GACCAATGTCAGAAAGATGATGG - Intronic
1020564638 7:9779448-9779470 GTCCCATGTCAGACAGGAATGGG - Intergenic
1023925280 7:44664370-44664392 GGCCCATTACAGCCTGGTGAGGG + Intronic
1026622410 7:71961654-71961676 GGCCCAGGGCAGAGAGGTGCAGG - Intronic
1026804567 7:73421921-73421943 GGCACATGGCAGGCAGGAGAAGG + Intergenic
1027139451 7:75646903-75646925 GACCAATGTCAGACTGGAGAGGG + Intronic
1027418039 7:77992997-77993019 GGCCCTGGACAGACAGTTGAGGG - Intergenic
1031989569 7:128188906-128188928 GTCCCATGTCAGCCAGGGAACGG + Intergenic
1034574226 7:151983623-151983645 GGCCCATGGCAGAGGGGTGGAGG + Intronic
1035250655 7:157594782-157594804 AGCCCAGGTCACACAGATGAAGG - Intronic
1037927759 8:22857912-22857934 GGGGCATGTAAGTCAGGTGACGG - Intronic
1039242301 8:35570192-35570214 GGCACACGTCAGACATGCGAGGG - Intronic
1044384754 8:91574360-91574382 GACCCATGTCAGACAGGGCTGGG + Intergenic
1045320799 8:101080343-101080365 GGCCCAGGGCAGAGAGGTCAGGG + Intergenic
1048183279 8:132215735-132215757 AGCCCATGACTGATAGGTGAGGG + Intronic
1051138563 9:13952341-13952363 GGCTCATGTCAGACATTTGGTGG - Intergenic
1056268426 9:84923046-84923068 GGCCAATGTCTGAAAGGTGGAGG - Intronic
1056582155 9:87897108-87897130 GTCCCATGTCAGGCAGCTGTAGG + Intergenic
1057007441 9:91573115-91573137 GGCCCATGTGAGACAGGAGAAGG + Intronic
1058295723 9:103304006-103304028 GGCATATGTAATACAGGTGAAGG + Intergenic
1059468885 9:114488534-114488556 GGCCCAAGACAGACAGGGGAGGG + Intronic
1059719681 9:116947179-116947201 GCCCCACGTCCAACAGGTGATGG - Intronic
1062529551 9:136993895-136993917 GGCCCAGGACAGGCAGGTGGAGG - Exonic
1186346785 X:8702257-8702279 GGCCAATGCCAGACAAATGATGG + Intronic
1192150789 X:68711082-68711104 GCCCCCTGCCAGACAGGTGGAGG + Intronic
1196939734 X:120763334-120763356 GGCCCATGGCAGGCAGGGAAAGG - Intergenic
1197770311 X:130085213-130085235 GGCCCAAGTAAGACAGGCGCTGG - Intronic
1198631207 X:138640594-138640616 GGACCATGTCAGTCAGCAGATGG + Intronic
1201730994 Y:17202869-17202891 TGACCATGTTAGCCAGGTGATGG + Intergenic
1202378609 Y:24258669-24258691 GGCACATGTCATGCAGGTGCGGG + Intergenic
1202492173 Y:25411452-25411474 GGCACATGTCATGCAGGTGCGGG - Intergenic