ID: 1133915591

View in Genome Browser
Species Human (GRCh38)
Location 16:10106705-10106727
Sequence GCCAACTTCCCCAAAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133915591_1133915593 1 Left 1133915591 16:10106705-10106727 CCACGGACTTTGGGGAAGTTGGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1133915593 16:10106729-10106751 CCTTCACTTCTAGAGAAAAAAGG 0: 1
1: 0
2: 6
3: 21
4: 251
1133915591_1133915595 14 Left 1133915591 16:10106705-10106727 CCACGGACTTTGGGGAAGTTGGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1133915595 16:10106742-10106764 AGAAAAAAGGAGAATAAGGCAGG 0: 1
1: 0
2: 16
3: 176
4: 1821
1133915591_1133915594 10 Left 1133915591 16:10106705-10106727 CCACGGACTTTGGGGAAGTTGGC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1133915594 16:10106738-10106760 CTAGAGAAAAAAGGAGAATAAGG 0: 1
1: 1
2: 5
3: 77
4: 1009

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133915591 Original CRISPR GCCAACTTCCCCAAAGTCCG TGG (reversed) Intronic
903983895 1:27210718-27210740 GCCAAGTTCCCCAAACCTCGTGG + Intergenic
908521403 1:64946395-64946417 GGTAACTTCCCCAAAGTCATAGG + Intronic
908637695 1:66186688-66186710 GGCAACTTCAGCAAAGTCTGAGG - Intronic
913056900 1:115170490-115170512 GCCAACTTCCCCATGGTTCCTGG + Intergenic
915448757 1:155990126-155990148 GACCACTTCCCCAAAGTCAGAGG - Intronic
919413567 1:197278026-197278048 GCCAACTTGCACACAGTACGTGG - Intronic
920724117 1:208417693-208417715 GCCACCTTCCCCACTGTCCTGGG + Intergenic
922373994 1:224942359-224942381 GGCAACTTCAGCAAAGTCCCAGG - Intronic
923012337 1:230098438-230098460 GCAAACTACCCCAAAGTCCGAGG + Intronic
924098494 1:240579169-240579191 GCCAGCTTCCCCACAGACAGTGG - Intronic
1063586456 10:7357421-7357443 GCTGACCTCCCCAAAGCCCGAGG + Intronic
1063601954 10:7490457-7490479 GCCAACTTCACCAAAAGCAGAGG - Intergenic
1065844673 10:29735400-29735422 GCTAACTTCCCGAAACTCCGCGG + Intronic
1067549301 10:47222399-47222421 GCCAACGTCTCCAAAGTCTAAGG - Intergenic
1068333152 10:55599167-55599189 GCCAAGTCCCCCAAAATCAGAGG + Intronic
1074055912 10:109923059-109923081 GCCAACTTCCTCCAAGAACGGGG + Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1077427872 11:2494202-2494224 GCCAACTTCAGCAAAGTCTTGGG - Intronic
1081645985 11:44791131-44791153 GCCCAGTTCCCCAAACTCAGAGG - Intronic
1082233088 11:49793094-49793116 CCTAACTTCCCCTAATTCCGTGG + Intergenic
1082247879 11:49945933-49945955 GGCAACTTCAGCAAAGTCTGAGG - Intergenic
1083223003 11:61265518-61265540 CCAAAGTTCCCCAAAGCCCGAGG + Intronic
1084189543 11:67492840-67492862 CACATCTTCCCCAGAGTCCGTGG + Intronic
1089924706 11:122245372-122245394 GGAAACTTCCCCAAGGTCCAGGG - Intergenic
1094841752 12:34345266-34345288 ACCCAGTTCCCCAAAGTCCCCGG + Intergenic
1099169219 12:79343939-79343961 GCAAATTTCCACAAACTCCGTGG + Intronic
1100215596 12:92444939-92444961 AACAACTTCCCCAAACTCTGAGG - Intergenic
1102637339 12:114335805-114335827 GCCCACTTCCCCAAAGAGCAGGG + Intergenic
1107968453 13:45618227-45618249 GGCAACTTCACCAAAGTCTTAGG - Intergenic
1110538030 13:76675001-76675023 CCCCAAATCCCCAAAGTCCGTGG - Intergenic
1114432517 14:22673901-22673923 AGCAACTTCACCAAAGTCCCAGG - Intergenic
1115360843 14:32500471-32500493 GCATACTTCCCCAGAGTCCCTGG + Intronic
1121017343 14:90556719-90556741 GCCACCTTCCCCAAAGTGCAGGG - Intronic
1122599626 14:102914849-102914871 GCCGCCTTCCCCAAGGTCCAAGG - Intergenic
1123672360 15:22672006-22672028 GCCAACTTCCCTCAAGCCAGGGG - Intergenic
1124324406 15:28745299-28745321 GCCAACTTCCCTCAAGCCAGGGG - Intergenic
1124528285 15:30478341-30478363 GCCAACTTCCCTCAAGCCAGGGG - Intergenic
1124770372 15:32529362-32529384 GCCAACTTCCCTCAAGCCAGGGG + Intergenic
1125337157 15:38638031-38638053 GCCAACTCCTCCAAAGTTAGGGG + Intergenic
1128564971 15:68695155-68695177 CCCAACTACCCCAAGGTCTGCGG + Exonic
1130318425 15:82817243-82817265 GCCAACTTCCCTCAAGGCAGGGG - Intronic
1131158956 15:90091899-90091921 GCCCAGTTCCCAACAGTCCGTGG - Intronic
1132217100 15:100072042-100072064 GGCAACTTCCGCAAAGTCTGAGG + Intronic
1132218693 15:100088125-100088147 GGCAACTTCCGCAAAGTCTCAGG + Intronic
1132742357 16:1421136-1421158 GCCGGCTTCCCCGAAGGCCGTGG + Intergenic
1132838270 16:1965446-1965468 GCCAAGTTCCCCCAACCCCGCGG - Intergenic
1133805596 16:9124017-9124039 GCTGACTTCCCCAAAGCCCAAGG - Intergenic
1133915591 16:10106705-10106727 GCCAACTTCCCCAAAGTCCGTGG - Intronic
1139761038 16:69185157-69185179 GCCAGGTTCACCAAAGTCTGAGG - Intronic
1142505661 17:361708-361730 GCTAAGTTCCCCATTGTCCGGGG - Intronic
1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG + Intronic
1143107759 17:4537985-4538007 TCCAATATCCCCAAGGTCCGAGG - Exonic
1146826680 17:36029111-36029133 CCCAAGTTCCCCAAGGTCAGTGG + Intergenic
1147886728 17:43689303-43689325 GCCATCTTCCCCACAGGCCCTGG + Intergenic
1150809831 17:68347611-68347633 GCCTACTTCCCCAAGGCCAGAGG - Intronic
1152573951 17:81132107-81132129 GCCAAAGTCTCCAAAGTCCTGGG + Intronic
1160837666 19:1132296-1132318 GCCTACTTCCTCTAAGGCCGGGG + Intronic
1162927676 19:13938327-13938349 GCCAGCTCCCCCAAAGCCCCGGG - Exonic
1164120328 19:22260129-22260151 GCCAGATTCCCCAAAGTCAGAGG + Intergenic
1167673129 19:50867298-50867320 GCAACCTACCCCAAAGTCTGAGG - Intronic
928097738 2:28414906-28414928 TTCAGCTTCCCCAAAGTCAGAGG + Exonic
931950899 2:67360386-67360408 GGCAACTTCAGCAAAGTCAGAGG + Intergenic
933653844 2:84871347-84871369 ACCAACATCCCCAAAGGCAGAGG + Intronic
938748015 2:134299200-134299222 ACCAACTTCCACAAAGTCAGTGG - Intronic
942115400 2:172724371-172724393 GCCAACCTCCCCAATAGCCGTGG + Intergenic
942528510 2:176882416-176882438 CCCAACTTCCCAACAGGCCGTGG - Intergenic
946650687 2:221890368-221890390 GCCTCCTTCCCCACGGTCCGAGG - Intergenic
1171308220 20:24124082-24124104 ACCCACTTCCCCAACGTCCTAGG - Intergenic
1173237374 20:41259167-41259189 GGCAACTTGCCCAAAGTCCATGG - Intronic
1175423943 20:58852784-58852806 GCCCCCTTACCCAAAGTCCCGGG + Exonic
1177099533 21:16883076-16883098 GGCAACTTCAGCAAAGTCTGAGG + Intergenic
1179941199 21:44639616-44639638 GCCAGCTGCCCCAAAAACCGGGG - Intronic
1182465697 22:30514796-30514818 GCCAGCTGCCCTAAAGTCCTGGG + Intergenic
1183282303 22:36938220-36938242 CCCAACATCCCCACAGCCCGAGG + Exonic
949777460 3:7648681-7648703 GCCAACTTCCCCTAGGACCTGGG + Intronic
953810460 3:46108242-46108264 GCCTCCTTCCCCAAATTCTGTGG - Intergenic
956269813 3:67439520-67439542 GGCAACTTCAGCAAAGTCTGAGG + Intronic
957061512 3:75485309-75485331 GGCAACTTCAGCAAAGTCTGAGG - Intergenic
957333512 3:78796590-78796612 CCTAACTTCCCCTAATTCCGTGG + Intronic
969477367 4:7429176-7429198 GGCACCTTCCCCAAAGCCCTAGG - Intronic
969703354 4:8779629-8779651 GCCAGCATCCCCAAAGGCCTGGG - Intergenic
971093385 4:23371112-23371134 ACCTACCTCCCCAAAGTCCGAGG - Intergenic
974959433 4:68679355-68679377 GGCAACTTCACCAAAGTCTGAGG - Intergenic
978336628 4:107676320-107676342 GCCAACTTCAGCAAAGTCTCAGG + Intronic
985766450 5:1782137-1782159 GCCAAGTTCCCCAATCTCCTGGG + Intergenic
992507249 5:77398920-77398942 CACACCTACCCCAAAGTCCGAGG + Intronic
994773703 5:104016754-104016776 TCCAACTCCCCCACAGACCGTGG + Intergenic
995134467 5:108665988-108666010 CCCAAAGTCCCCAAAGTCCATGG + Intergenic
996851563 5:127958911-127958933 GGCAAATTCCCCTAAGTCCAAGG + Intergenic
1003933243 6:10948810-10948832 CCCAAATTCCCCAAATTCCCAGG - Intronic
1004512864 6:16296923-16296945 GTCAACCTCCCCAAAGTGCTAGG + Intergenic
1004939987 6:20545679-20545701 GCCCACCTCCCCAAAGTGCTGGG + Intronic
1005790863 6:29299159-29299181 GGCAACTTCAGCAAAGTCTGAGG + Intergenic
1005996238 6:30933143-30933165 TCCACCTTCCCCAAAGCCAGCGG + Intergenic
1006721192 6:36152718-36152740 TCCTACTTCCCCAAAGGCAGAGG - Intergenic
1007322601 6:41038436-41038458 GCCAACTTCTCCAGGGTCGGAGG - Intronic
1008671950 6:53778298-53778320 GGCAACTTCAGCAAAGTCTGAGG + Intergenic
1008759926 6:54842131-54842153 GGTAACTTCCCCAAAGTACTTGG + Intergenic
1009239341 6:61164819-61164841 GACAACTTCACCAAAGTCTCAGG - Intergenic
1010582357 6:77615347-77615369 GGCAACTTCAGCAAAGTCCCAGG - Intergenic
1018892137 6:167989953-167989975 GCCAAATCCCCCAAAGCCCAGGG + Intergenic
1020924697 7:14310880-14310902 CCCACCTTCCCCAAAGTGCTGGG - Intronic
1024262254 7:47581679-47581701 GCCAGCTTCGCCGGAGTCCGGGG - Intronic
1024303893 7:47910270-47910292 GCCAAATTCCTCTGAGTCCGTGG - Intronic
1031393797 7:121247889-121247911 GCCAACTTCCCCACAGGACTGGG + Intronic
1035113861 7:156506557-156506579 GCAGTCTTCCCCAAAGACCGAGG + Intergenic
1036586943 8:10133163-10133185 ACCGCCTTCCCCACAGTCCGTGG - Intronic
1040309555 8:46229682-46229704 GGCAACTTCTCCAAAGCCTGGGG - Intergenic
1040333980 8:46406800-46406822 GCCAACTGCTTCAAAGTCTGGGG - Intergenic
1040530841 8:48265351-48265373 GCCAAGATACCCACAGTCCGAGG + Intergenic
1045247748 8:100458411-100458433 GCCAACCTCCCAAAACTTCGGGG - Intergenic
1052484667 9:29081718-29081740 GGCAACTTCAACAAAGTCTGAGG + Intergenic
1052686948 9:31769015-31769037 GACAATCTCCCCAAAGTCCTGGG - Intergenic
1055819422 9:80244023-80244045 GCCAGCTTTCCCAAAGCCCTAGG - Intergenic
1057290049 9:93800683-93800705 CACACCTTCCCCAAAGTCAGAGG + Intergenic
1061867394 9:133499904-133499926 TGCAACTTTCCCAAAGTCTGTGG - Intergenic
1189202868 X:39212697-39212719 GCCAGTTTCCCCAAAGTCTGAGG + Intergenic
1191895952 X:65993760-65993782 GACCACTTCCCCAAATTCTGTGG - Intergenic
1192428336 X:71096382-71096404 GCGAACTTCCCCCTAGTCCCAGG - Exonic
1195084333 X:101400062-101400084 GCCTGCCTCCCCAAAGTCCAAGG - Intronic
1198856298 X:141020638-141020660 GGCAACTTCAGCAAAGTCTGAGG + Intergenic
1198881529 X:141286287-141286309 GGCAACTTCAGCAAAGTCCCAGG - Intergenic
1198906394 X:141566729-141566751 GGCAACTTCAGCAAAGTCTGAGG - Intergenic
1198916698 X:141680397-141680419 GGCAACTTCAGCAAAGTCTGAGG - Intronic
1199233156 X:145462430-145462452 GGCAACTTCAGCAAAGTCTGAGG + Intergenic