ID: 1133916091

View in Genome Browser
Species Human (GRCh38)
Location 16:10111390-10111412
Sequence CGGTGCCGCCACTGATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133916091_1133916093 -8 Left 1133916091 16:10111390-10111412 CCATCTGATCAGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1133916093 16:10111405-10111427 CGGCACCGGCTACGTGCCCCAGG 0: 1
1: 1
2: 2
3: 10
4: 74
1133916091_1133916095 -3 Left 1133916091 16:10111390-10111412 CCATCTGATCAGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1133916095 16:10111410-10111432 CCGGCTACGTGCCCCAGGACTGG 0: 1
1: 0
2: 6
3: 10
4: 81
1133916091_1133916099 23 Left 1133916091 16:10111390-10111412 CCATCTGATCAGTGGCGGCACCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1133916099 16:10111436-10111458 ACCGTGCAGCAGCTCTTCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133916091 Original CRISPR CGGTGCCGCCACTGATCAGA TGG (reversed) Intronic
902993195 1:20204034-20204056 TGGCGCAGCCACTGAACAGAGGG + Intergenic
905009722 1:34739202-34739224 CGGTGCCTCCTCTGACTAGAGGG + Intronic
906341680 1:44986460-44986482 CGGTGGGGCCACTCATCTGAGGG - Intronic
910415377 1:86992024-86992046 TAGTGCTGCCACTGATCTGACGG - Intronic
917748789 1:178036311-178036333 TGATGCCGCCACTGATCTGACGG - Intergenic
918037492 1:180889387-180889409 CTGTGCCACCACAAATCAGAGGG + Exonic
1068603344 10:58978626-58978648 CAATGCTGCCACTGATCTGACGG + Intergenic
1073199939 10:101727197-101727219 TAATGCCGCCACTGATCTGATGG + Intergenic
1074744031 10:116513586-116513608 TAATGCTGCCACTGATCAGACGG + Intergenic
1075715538 10:124553147-124553169 TGGTGCTGCCACTCATCAGCTGG - Intronic
1101575441 12:105992982-105993004 CAGTGCAGCCACTGAACAAATGG + Intergenic
1101902118 12:108798572-108798594 AGGTTCCGCCACTGATGAGCAGG - Intronic
1117976013 14:61297686-61297708 TAGTGCTGCCACTGATCTGACGG + Intronic
1128152729 15:65373323-65373345 TGGTGCAGCCTCTGAGCAGATGG - Intronic
1129774876 15:78230083-78230105 CGGTGTCTCCACTGGACAGAGGG + Intronic
1130020858 15:80230279-80230301 CGGTGTCTCCATTGATAAGAAGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133916091 16:10111390-10111412 CGGTGCCGCCACTGATCAGATGG - Intronic
1152212342 17:79009304-79009326 AGGTGCCCACACTAATCAGAGGG + Intronic
1158216081 18:55102226-55102248 CAATGCTGCCACTGATCTGATGG + Intergenic
1160531462 18:79567488-79567510 TGGTGCCGCCCCTGGTCAGGGGG + Intergenic
1160932524 19:1577401-1577423 CTGTGTCGCCACTAAACAGAAGG + Exonic
1162792932 19:13072336-13072358 CGGTGCCACAGCTGCTCAGAGGG - Intronic
924958986 2:17089-17111 CAGTGGCGCCAAGGATCAGAAGG + Intergenic
931255738 2:60570495-60570517 CGGTGCCGCCCAGGATCAAATGG - Intergenic
947211181 2:227710076-227710098 TAATGCCGCCACTGATCTGACGG + Intronic
1184634344 22:45814799-45814821 TAATGCCGCCACTGATCTGACGG - Intronic
1185270891 22:49928989-49929011 CGGAGCCGCCGTTGATCAGGTGG + Intergenic
995548050 5:113252364-113252386 CAATGCCACCACTGATCTGATGG - Intronic
1003324966 6:5084668-5084690 CCGCGCCGCCACTGGGCAGATGG + Exonic
1003461271 6:6330964-6330986 CTGTGCCTACACTGCTCAGAGGG - Intergenic
1007066944 6:39000489-39000511 TAATGCCGCCACTGATCTGACGG - Intronic
1008278001 6:49563194-49563216 CAGTGCCGCTGCTGATCTGACGG - Intergenic
1013501019 6:110751319-110751341 TAATGCCGCCACTGATCTGACGG - Intronic
1014859790 6:126451639-126451661 TCATGCCTCCACTGATCAGAAGG - Intergenic
1019080017 6:169424162-169424184 CGGTGACGCCATTGATCAACAGG + Intergenic
1025229107 7:57188142-57188164 CGGGGGCGCCAGTTATCAGAGGG - Intergenic
1031857344 7:126938240-126938262 GGGTGCCACCACTGAGCACATGG + Intronic
1032587830 7:133163979-133164001 CGATGCTGCCACTGATCTGATGG + Intergenic
1049986800 9:959365-959387 TGGTGCCACCACTTGTCAGAGGG + Intronic
1051390088 9:16554691-16554713 CAGAGCAGCCACTCATCAGAAGG - Intronic
1057441980 9:95089904-95089926 CAGCGCCTCCACTGAACAGACGG + Intergenic
1203567450 Un_KI270744v1:103326-103348 CGGGGGCGCCAATTATCAGAGGG + Intergenic