ID: 1133919006

View in Genome Browser
Species Human (GRCh38)
Location 16:10135183-10135205
Sequence AATTATATGCTACAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133919006_1133919007 8 Left 1133919006 16:10135183-10135205 CCACACAACTGTAGCATATAATT 0: 1
1: 0
2: 0
3: 28
4: 398
Right 1133919007 16:10135214-10135236 TGCTCTGCCACTATATAACAAGG 0: 1
1: 0
2: 4
3: 66
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133919006 Original CRISPR AATTATATGCTACAGTTGTG TGG (reversed) Intronic
900186440 1:1335267-1335289 AATTTTATGGGACAGATGTGTGG - Exonic
902100867 1:13987551-13987573 AATTTTTTTCTACAGTTCTGGGG + Intergenic
906552632 1:46678347-46678369 AAGTATCTGCTACAGTAGTTTGG + Exonic
909215802 1:72886761-72886783 AATAATATTCTAGAGCTGTGTGG - Intergenic
909227853 1:73047942-73047964 AAATATATTCTGCAGTTGTTGGG - Intergenic
910109437 1:83667050-83667072 AATTTTATCCTCCAGGTGTGAGG - Intergenic
911731154 1:101293660-101293682 AATTTTATGCTTCAGTTGGAAGG + Intergenic
911984092 1:104599953-104599975 AAGTATATGCATCAGGTGTGAGG - Intergenic
912815046 1:112822273-112822295 AAGTATATGCATCAGGTGTGAGG + Intergenic
913235935 1:116783377-116783399 AATTTTATGGTATATTTGTGTGG + Intergenic
914706457 1:150174011-150174033 AATTATAGGCTGCAGTGTTGTGG - Intergenic
916398541 1:164419322-164419344 AATTAAAGGCTACAGCTTTGAGG - Intergenic
917750799 1:178051615-178051637 CATTATATGCCACAGTGGAGAGG - Intergenic
917977248 1:180248146-180248168 AACTATATGCAACAGCTCTGCGG + Intronic
918545799 1:185682439-185682461 AATAATATGCTCTAGTTTTGTGG - Intergenic
919589183 1:199478986-199479008 AATTATATGTTACAGATCTGTGG - Intergenic
919603908 1:199656524-199656546 AATTATATGCTATAGGGGAGTGG - Intergenic
920768641 1:208858413-208858435 AAATTTATGGTACTGTTGTGAGG - Intergenic
920901320 1:210112932-210112954 AAGTATATGCGTCAGGTGTGAGG + Intronic
921763810 1:218947109-218947131 AATTATCTCACACAGTTGTGAGG + Intergenic
922716740 1:227879758-227879780 AATTATATTTTACATTTTTGAGG - Intergenic
922845138 1:228678758-228678780 AAGTATATGCATCAGGTGTGAGG + Intergenic
922877308 1:228949983-228950005 AATTATATGCGTCAGGTATGAGG - Intergenic
923213969 1:231832169-231832191 AAGTATATGCCTCAGGTGTGAGG + Intronic
923397026 1:233575993-233576015 AACTACATTCTACAGTTATGTGG - Intergenic
923844826 1:237718322-237718344 AATTACATGCTACAAATTTGGGG - Intronic
924180921 1:241437930-241437952 AAGTATATGCATCAGGTGTGAGG - Intergenic
924879916 1:248149773-248149795 ATGTATATTCTACAGTTGTTGGG + Intergenic
1064233775 10:13554545-13554567 AAATAAATGCTACAGTTATGTGG + Intergenic
1066091525 10:32026068-32026090 CATTGTATTCTATAGTTGTGTGG - Intronic
1067539154 10:47139083-47139105 TATTATAAGCTACAGCAGTGTGG - Intergenic
1067900712 10:50238504-50238526 AATAATATGCGAGAGTGGTGGGG - Intronic
1068399241 10:56507568-56507590 ACTTACATGCTACAGCTGTGTGG - Intergenic
1071247185 10:83777516-83777538 ATATATATGCTACAATTGTTGGG - Intergenic
1071416101 10:85443056-85443078 AATTTTATGCTACAGTTAAAAGG - Intergenic
1073583014 10:104684695-104684717 AATTTTATGATATAGTTGAGGGG + Intronic
1073683735 10:105730965-105730987 AAGTATATGCATCAGGTGTGAGG - Intergenic
1074596147 10:114868821-114868843 AATGATGTGCTAAAGTTGTCCGG + Intronic
1074741031 10:116484562-116484584 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1077678847 11:4221236-4221258 AAGTATATGCATCAGGTGTGAGG + Intergenic
1077688283 11:4317876-4317898 AAGTATATGCATCAGGTGTGAGG + Intergenic
1078574781 11:12490776-12490798 ATTTATGTGCTACGGTTGTATGG - Intronic
1078789280 11:14526581-14526603 AAGTATATGCGTCAGGTGTGAGG - Intronic
1079337202 11:19580361-19580383 ATTTATATTTTACAGTTATGGGG + Intronic
1081020671 11:37944554-37944576 ACTTATATTCTGCAGTTGTTGGG + Intergenic
1082777415 11:57257652-57257674 ATTTATTTGCCACAGTTCTGGGG - Intergenic
1084232527 11:67763413-67763435 AAGTATATGCATCAGCTGTGAGG - Intergenic
1084613028 11:70216087-70216109 AAGTATATGCATCAGGTGTGAGG + Intergenic
1084922152 11:72479878-72479900 AATCATTTGCTCCAGATGTGAGG - Intergenic
1085790099 11:79489938-79489960 AATTAAATACTACATTTATGTGG - Intergenic
1086124066 11:83331885-83331907 AAATAAAGGCTGCAGTTGTGTGG - Intergenic
1087839279 11:102905838-102905860 AAGTATATGCATCAGGTGTGAGG + Intergenic
1089866821 11:121639887-121639909 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1089953593 11:122551076-122551098 AAGTATATGCACCAGGTGTGAGG - Intergenic
1090218923 11:124998052-124998074 AATTGTGTCCTACAGTTGTATGG + Intronic
1090526550 11:127544490-127544512 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1090546240 11:127770833-127770855 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1090564206 11:127968961-127968983 AATTATATGCAACTGATGGGGGG - Intergenic
1092318249 12:7441930-7441952 AAGTTTATGCTACACGTGTGGGG + Intronic
1092330671 12:7584012-7584034 TATTATATGCTACAGTTGATAGG - Intergenic
1094042352 12:26131537-26131559 AATTGTATGCTACATAAGTGTGG - Intronic
1094044727 12:26154861-26154883 AATTATATGAGAAAGTAGTGGGG + Intronic
1096906989 12:54945065-54945087 AAGTATATGCATCAGATGTGAGG + Intergenic
1096930084 12:55198439-55198461 AATTGTATCCTGCAGTTGTGTGG + Intergenic
1097449050 12:59713647-59713669 AAGTATATGCTTCAGGAGTGTGG + Intronic
1097622222 12:61953551-61953573 ATTTATTTGCTACATTTTTGTGG + Intronic
1098125462 12:67288050-67288072 AAGTATATTCTGCAGTTGTTGGG + Intronic
1098173414 12:67768607-67768629 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1098402480 12:70089151-70089173 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1098503346 12:71220266-71220288 AATTGTATTTTTCAGTTGTGAGG - Intronic
1098653567 12:73003766-73003788 AAGTATATGCATCAGGTGTGAGG + Intergenic
1098940064 12:76523751-76523773 ATTTATTTTCTACAGTTCTGGGG - Intronic
1100480864 12:94977510-94977532 AATCATTTGTTACAGTTTTGTGG - Intronic
1100652555 12:96606284-96606306 AATTTTAGCCTACAGTTGAGTGG + Intronic
1101278172 12:103224642-103224664 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1101978040 12:109379355-109379377 ATGTATATGCTCCAGTTGTTGGG + Intronic
1102074981 12:110052563-110052585 AACTATCTCCTACTGTTGTGAGG - Intronic
1102585107 12:113917381-113917403 AATTAGAAACTACAGGTGTGGGG + Intronic
1105032509 12:132893828-132893850 AATTATATGTATCAGGTGTGAGG - Intronic
1105598650 13:21864930-21864952 AATTATATTCTGTAGTTGTTGGG + Intergenic
1105990175 13:25612598-25612620 ATTTATATCCTGCAGTTGTTGGG + Intronic
1107195035 13:37641387-37641409 AATTATATTCCACAATTATGTGG + Intronic
1107220039 13:37970937-37970959 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1108939926 13:55940095-55940117 AATTACATGCTACAGTTATATGG - Intergenic
1109343856 13:61092485-61092507 AAATATATGCGTCAGGTGTGAGG - Intergenic
1109706249 13:66095989-66096011 AATTATGTCCTACATTTATGTGG + Intergenic
1109810188 13:67503233-67503255 AATTATATGTCACAGTAATGAGG + Intergenic
1110031760 13:70624410-70624432 AGTTATATTGGACAGTTGTGTGG - Intergenic
1110698627 13:78520845-78520867 AATTATATGGCAAAGGTGTGGGG - Intergenic
1110845570 13:80187428-80187450 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1110978709 13:81869928-81869950 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1111148699 13:84219089-84219111 ATTTATATTCTACAGTTATTGGG - Intergenic
1112176144 13:97027004-97027026 AATTATGTCCTGCAGTTATGTGG + Intergenic
1113157328 13:107338714-107338736 TATTACATAATACAGTTGTGAGG + Intronic
1113534813 13:111057290-111057312 ATGTATATTCTACAGTTGTTGGG + Intergenic
1114232715 14:20798745-20798767 AATTAGATGCCACGGTGGTGGGG - Intergenic
1115111345 14:29827209-29827231 AATTATTTGCTAGATTTGGGGGG - Intronic
1116702136 14:48257134-48257156 AAGTATATGCATCAGGTGTGAGG + Intergenic
1116703067 14:48264329-48264351 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1118936981 14:70297383-70297405 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1119560006 14:75582418-75582440 AAGTATATGCATCAGGTGTGAGG + Intronic
1121389749 14:93563881-93563903 AAGTATATGCATCAGGTGTGAGG + Intronic
1121703910 14:95976911-95976933 AAGTATATGCATCAGGTGTGAGG - Intergenic
1122041220 14:98988947-98988969 AAGTATATGCTTCAGGTATGAGG - Intergenic
1122507900 14:102243579-102243601 AAGTATATGCATCAGGTGTGAGG - Intronic
1122682857 14:103479430-103479452 GATAAAATGGTACAGTTGTGAGG - Intronic
1122995328 14:105260856-105260878 AATTATGTGCTTCCCTTGTGAGG + Intronic
1124607523 15:31181280-31181302 AATTATATTGTACTGTTTTGGGG - Intergenic
1125142536 15:36425840-36425862 AATTATATGCTTAAATTATGAGG - Intergenic
1126325083 15:47467921-47467943 ATTTTTATGCTACAGATGAGGGG - Intronic
1126832049 15:52617880-52617902 AATTATGTGTTACAATTATGTGG - Intronic
1128028128 15:64456536-64456558 AATTCTATGCTGGAGTTGTCTGG + Intergenic
1129259685 15:74357887-74357909 AAGTATATGCATCAGGTGTGAGG - Intronic
1129556433 15:76515083-76515105 AATTATAAGCTACAGTTTGAAGG + Intronic
1130304816 15:82706214-82706236 AAGTATATGCGTCAGGTGTGAGG - Intronic
1130347489 15:83061807-83061829 TATTATCTTTTACAGTTGTGTGG - Intronic
1130781332 15:87043608-87043630 AAGTATATGCATCAGGTGTGAGG - Intergenic
1130850371 15:87787071-87787093 AATTATATTCTTTTGTTGTGTGG + Intergenic
1133919006 16:10135183-10135205 AATTATATGCTACAGTTGTGTGG - Intronic
1133939027 16:10293058-10293080 AAGTATATGCATCAGGTGTGAGG - Intergenic
1136392882 16:29976466-29976488 AATTACATGCTAAAATTGTTAGG + Intronic
1137066136 16:35845920-35845942 AATTCTATGTTACACTTTTGAGG - Intergenic
1138805173 16:60082582-60082604 AAGTATATGCATCAGGTGTGAGG - Intergenic
1139942830 16:70618443-70618465 AATTATATGCGTCAGGTATGAGG + Intronic
1139943495 16:70622757-70622779 AAGTATATGCTTCAGGTATGAGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141688062 16:85581513-85581535 AGGTTTATGCCACAGTTGTGGGG + Intergenic
1144440733 17:15278827-15278849 AATTATGTGAAACAGTGGTGTGG - Intergenic
1146655796 17:34634392-34634414 AATTGTGTCCTGCAGTTGTGTGG - Intronic
1146828996 17:36050512-36050534 AATTATATTCTGCAGTTGTTGGG - Intergenic
1147032779 17:37653849-37653871 AATTATATTCTGCAGTTGCTTGG - Intergenic
1148010569 17:44477300-44477322 AATTAGGTGCTAAAATTGTGTGG + Intronic
1148725524 17:49787246-49787268 AATTAAATGCTTAAGTGGTGAGG + Intronic
1152501603 17:80714379-80714401 ATGTATATTCTACAGTTGTGTGG - Intronic
1154462208 18:14603363-14603385 AATTGTATTCTACTGTTGTTTGG - Intergenic
1155174089 18:23288009-23288031 AAGTATATGCTTCAGGTGTGAGG - Intronic
1156173725 18:34517152-34517174 AATCTTATGCAACAGTTATGTGG - Intronic
1156180993 18:34604031-34604053 AAATATGTGTTATAGTTGTGAGG + Intronic
1157053170 18:44194317-44194339 AATTTTGTGCTACAATTGTGGGG - Intergenic
1159164708 18:64685378-64685400 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1159219725 18:65443990-65444012 TCTTATATGCTTCAGTTGTCAGG - Intergenic
1159447127 18:68554748-68554770 AGGTAAATGCTAAAGTTGTGAGG - Intergenic
1159453825 18:68636373-68636395 ATGTATATTCTACAGTTGTTGGG + Intergenic
1159678937 18:71322835-71322857 AATTAATTGCTACAGTTATAAGG - Intergenic
1159838970 18:73373945-73373967 ATCTATATTCTGCAGTTGTGGGG - Intergenic
1160201362 18:76798530-76798552 AATTAAAGGCTCCAGTTTTGGGG + Intronic
1164003801 19:21131337-21131359 AAGTATATGCATCAGGTGTGAGG + Intergenic
1165496777 19:36157384-36157406 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1165524606 19:36343397-36343419 ATTTATTTGGAACAGTTGTGGGG - Intronic
1165835588 19:38753359-38753381 AAGTATATGCGTCAGGTGTGAGG - Intronic
1166905496 19:46105648-46105670 AAGTATATGCATCAGGTGTGAGG + Intergenic
1167901396 19:52624854-52624876 AAGTATATGCATCAGGTGTGAGG - Intronic
1168211903 19:54896856-54896878 AAGTATATGCGTCAGGTGTGAGG + Intergenic
925090023 2:1147767-1147789 AATGACTAGCTACAGTTGTGTGG + Intronic
925433566 2:3817479-3817501 AAATATATGCATCAGGTGTGAGG + Intronic
926266625 2:11328289-11328311 AATAATATGCTACATTTGGGGGG + Intronic
927134421 2:20086274-20086296 AAGTATATGCATCAGGTGTGAGG - Intergenic
927359897 2:22220951-22220973 AATTACATTGTACAGTTGGGTGG + Intergenic
927715858 2:25352252-25352274 AAATATATACTAAAGTTGTCGGG + Intergenic
927818635 2:26243476-26243498 AAATACATGCTACAGTTTTGTGG + Intronic
927988011 2:27427124-27427146 AATTATATCCTAAATTTGTTGGG + Intergenic
928566969 2:32562486-32562508 CTTTATGTTCTACAGTTGTGTGG + Intronic
928771022 2:34702098-34702120 AAGTATATGCGTCAGGTGTGAGG - Intergenic
928779484 2:34802930-34802952 AAGTATATGCGTCAGGTGTGAGG + Intergenic
928827404 2:35438851-35438873 AAGTATATGCGTCAGGTGTGAGG + Intergenic
928857396 2:35816836-35816858 AAGTATATGCGTCAGGTGTGAGG - Intergenic
929076446 2:38082727-38082749 AAGTATATGCGTCAGGTGTGAGG + Intronic
929684267 2:44020796-44020818 AAGTATATGCGTCAGGTGTGAGG + Intergenic
930706465 2:54509373-54509395 AAGTATATGCATCAGGTGTGAGG + Intronic
930949173 2:57116432-57116454 AATTATATTTTCTAGTTGTGTGG + Intergenic
931948512 2:67335562-67335584 AAGTATATGCTTCAGGTGTGAGG - Intergenic
932159171 2:69445236-69445258 AAGTATATGCATCAGGTGTGAGG + Intergenic
933044252 2:77515334-77515356 AATTGCATGCTATATTTGTGTGG + Intronic
933097551 2:78205795-78205817 ATTTATATTCTATAGTTGTTAGG - Intergenic
933883762 2:86698603-86698625 AATTAAATGCTGCTTTTGTGGGG + Intronic
935000799 2:99012855-99012877 ATTTATATTCTGCAGTTGTTGGG - Intronic
935483807 2:103627512-103627534 GATAATATGCAACAGGTGTGAGG - Intergenic
939152311 2:138487431-138487453 AATTATATCCTTCAGTGGGGAGG - Intergenic
939581403 2:143952382-143952404 AATAATATGCAACTGTTGTACGG - Intronic
940508557 2:154585194-154585216 AAGTATATGCGTCAGGTGTGAGG + Intergenic
941386982 2:164865953-164865975 ATGTATATGCTATAGTTGTAGGG + Intergenic
941492506 2:166159784-166159806 ATTTATATGCTACATTTTTAAGG - Intergenic
941492632 2:166161650-166161672 ATTTATATGCTACATTTTTAAGG + Intergenic
941548115 2:166879233-166879255 ATTTTTAAGCTACAGTTGTTGGG + Intergenic
942730034 2:179053512-179053534 AAGTATATGCATCAGGTGTGAGG + Intergenic
942988479 2:182170532-182170554 AATTATATGGTATAGCTATGCGG - Intronic
943061822 2:183047822-183047844 AAGTATATGCATCAGGTGTGAGG - Intergenic
943096076 2:183430882-183430904 ATTTATATCTTACAGTTCTGTGG + Intergenic
943806864 2:192134163-192134185 AAGTATATGCGTCAGGTGTGAGG - Intronic
944394361 2:199250679-199250701 AATTATATGCGTCAGGTATGAGG - Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
945173736 2:207021367-207021389 AAGTATATGCGTCAGGTGTGAGG - Intergenic
945337855 2:208614488-208614510 ATGTATATTCTACAGTTGTTGGG + Intronic
945766625 2:213988279-213988301 AAGTATATTCTACTGTTGTTGGG - Intronic
945858405 2:215093711-215093733 AAGTATATGCATCAGGTGTGAGG - Intronic
947507616 2:230721107-230721129 TATTAAATGATACAGCTGTGTGG + Intronic
1170325231 20:15149577-15149599 AAGTATATGCGTCAGGTGTGAGG + Intronic
1170919547 20:20664440-20664462 AATTATATGCTACTAATTTGGGG - Intronic
1171066733 20:22024442-22024464 ATGTATATTCTACAGTTGTTGGG + Intergenic
1171198324 20:23220579-23220601 ATGTATATTCTACAGTTGTTGGG + Intergenic
1172020817 20:31912742-31912764 ATTTCTATGTTACAGTTTTGAGG + Intronic
1174737704 20:52981409-52981431 AATCATATGTTCCAGGTGTGTGG + Intronic
1176685875 21:9848154-9848176 AAGTATATGCATCAGGTGTGAGG - Intergenic
1177119798 21:17125238-17125260 AAGTATATGCATCAGGTGTGAGG - Intergenic
1177840491 21:26229775-26229797 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1177840496 21:26229820-26229842 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1178001417 21:28164952-28164974 AAGTATATGCATCAGGTGTGAGG - Intergenic
1179260446 21:39753438-39753460 ATTTATACTCTACAGTTGTTGGG + Intronic
1181358445 22:22316650-22316672 AATGCTATGCCACAGTTTTGGGG - Intergenic
1182950345 22:34369110-34369132 AAGTATATTCTATTGTTGTGGGG + Intergenic
1183635371 22:39059044-39059066 AAGTATATGCATCAGGTGTGAGG + Intronic
949827667 3:8180759-8180781 AAGTATATGCTTCAGGTATGAGG - Intergenic
949849271 3:8406059-8406081 AATTGCACCCTACAGTTGTGTGG + Intergenic
951316060 3:21190947-21190969 AAGTATATGCATCAGGTGTGAGG + Intergenic
952366118 3:32676485-32676507 AATTATATTTTAAAGTTGTGTGG + Intergenic
952894940 3:38072251-38072273 AAGTATATGCGTCAGGTGTGAGG + Intronic
953505152 3:43478746-43478768 AATTATCTGCTACATATGTATGG - Intronic
953639363 3:44691638-44691660 ATATATATTCTACAGTTGTTGGG - Intergenic
953834210 3:46329090-46329112 AAGTATATGCATCAGGTGTGAGG + Intergenic
954161500 3:48726069-48726091 AAGTATATGCGTCAGGTGTGAGG + Intronic
954941547 3:54377515-54377537 AATAATATTTTACACTTGTGTGG + Intronic
956825032 3:72989807-72989829 AATTATATACTAAAGTTTTCGGG + Intronic
957904574 3:86539967-86539989 AAGTATATGCATCAGGTGTGAGG + Intergenic
957985979 3:87573443-87573465 AAGTATATGCAGCAGGTGTGAGG - Intergenic
958751263 3:98195056-98195078 AAGTATATGCGTCAGGTGTGAGG - Intronic
958794639 3:98693763-98693785 ATTTATATGCTCCAAGTGTGGGG - Intergenic
960158193 3:114319105-114319127 AAGGATATGCTGCAGTTTTGAGG - Intergenic
961293739 3:125867554-125867576 AAGTATATGCGTCAGGTGTGAGG - Intergenic
961707369 3:128797733-128797755 AAATATAGGGTACAGATGTGGGG - Intronic
962660893 3:137599437-137599459 AAGTATATGCCTCAGGTGTGAGG - Intergenic
962764862 3:138552352-138552374 ATGTATATTCTACAGTTGTTGGG - Intronic
962825626 3:139098096-139098118 ATTTTTATTCTACAGTTGTTGGG + Intronic
963058885 3:141208909-141208931 AAGTATATGCGTCAGGTGTGAGG - Intergenic
963395134 3:144722583-144722605 AAATATATGATAAAGTTGTGGGG - Intergenic
964075878 3:152690966-152690988 ATGTATATTCTACAGTTGTTGGG - Intergenic
964125229 3:153228648-153228670 AAGTATATGCATCAGGTGTGAGG + Intergenic
964300000 3:155276932-155276954 AAGTATATGCATCAGGTGTGAGG + Intergenic
964393583 3:156222607-156222629 ATGTATATTCTACAGTTGTTGGG - Intronic
964626107 3:158761681-158761703 AATTATATGCTGTACTGGTGGGG - Intronic
964772858 3:160242543-160242565 ATGTATATTCTACAGTTGTTGGG - Intronic
964817027 3:160728288-160728310 AATTATATGCTCTTATTGTGGGG - Intergenic
965032769 3:163394251-163394273 AATTATATACTAAAGTTGTTAGG - Intergenic
965250352 3:166335370-166335392 AATTACATGCTTCAGTTGCTTGG - Intergenic
965335380 3:167426719-167426741 AAGTATATGCATCAGGTGTGAGG - Intergenic
965336590 3:167435178-167435200 AAGTATATGCATCAGGTGTGAGG - Intergenic
965789087 3:172368388-172368410 AATTAAATGAAACAGATGTGAGG + Intronic
966166713 3:177027520-177027542 AAATATATGCTTCAGGTGTTCGG + Intronic
966457282 3:180131899-180131921 AATTATAAGCAACTGTTTTGTGG + Intergenic
967496444 3:190148250-190148272 AAGTATATGCTTCAGGTATGAGG - Intergenic
967736265 3:192956148-192956170 AATTCTGTGTCACAGTTGTGTGG + Intergenic
969003565 4:4002011-4002033 AAGTATATGCATCAGGTGTGAGG + Intergenic
969653801 4:8484369-8484391 AAGTATATGCGTCAGGTGTGAGG + Intronic
969810359 4:9642812-9642834 AAGTATATGCATCAGGTGTGAGG - Intergenic
970028968 4:11655493-11655515 AAGTATATGCGTCAGGTGTGAGG + Intergenic
970292003 4:14583094-14583116 AATTATATTCTGCTGTTGTGCGG - Intergenic
970591485 4:17564014-17564036 CAGTATATCCAACAGTTGTGGGG + Intergenic
970844791 4:20523596-20523618 AATTAGAGGCTAGAGATGTGGGG - Intronic
972968575 4:44544142-44544164 ACTTATTTAATACAGTTGTGTGG - Intergenic
973175354 4:47198648-47198670 AATTGTATTCTACAGTTAGGAGG + Intronic
973889957 4:55358900-55358922 AATCATGTGTAACAGTTGTGTGG + Intronic
976660694 4:87537296-87537318 AATTATGTTCTACTGTTGGGTGG - Intergenic
976986038 4:91299253-91299275 CTTAATATGCTACATTTGTGAGG + Intronic
977012708 4:91656582-91656604 AAGTATATGCATCAGGTGTGAGG + Intergenic
977762984 4:100761560-100761582 ATGTATATTCTACAGTTGTTGGG - Intronic
979850085 4:125563595-125563617 AAGTATATGCGTCAGGTGTGAGG + Intergenic
980324485 4:131324139-131324161 AATTGTTTGCTGCAGATGTGGGG + Intergenic
981341336 4:143625284-143625306 AGTTACATTCTGCAGTTGTGTGG + Intronic
982413943 4:155110247-155110269 AAGTATATGCATCAGGTGTGAGG + Intergenic
982991253 4:162278323-162278345 AATTTAATGCTGCAGTAGTGAGG - Intergenic
983056354 4:163102532-163102554 AAGTATATGCATCAGGTGTGAGG + Intergenic
983345818 4:166524482-166524504 AAGTATATGCATCAGGTGTGAGG - Intergenic
983414510 4:167437887-167437909 AAGTATATGCGTCAGGTGTGAGG + Intergenic
983448280 4:167880070-167880092 AAGTATATGCATCAGGTGTGAGG - Intergenic
983452562 4:167926639-167926661 AAGTATATGCATCAGGTGTGAGG - Intergenic
984165128 4:176296811-176296833 AAGTATATGCATCAGGTGTGAGG + Intergenic
984322408 4:178210837-178210859 AAGTATATGCGTCAGGTGTGAGG - Intergenic
985057138 4:186045953-186045975 AAGTATATGCATCAGGTGTGAGG + Intergenic
985435965 4:189929814-189929836 AAGTATATGCGTCAGGTGTGAGG - Intergenic
985667509 5:1189087-1189109 AATTATCTCCTACATTTTTGAGG - Intergenic
986246692 5:6013678-6013700 ATTTATTTGTTACAGTTTTGAGG + Intergenic
986474617 5:8114838-8114860 AATTTTATGCTCCCATTGTGAGG - Intergenic
986482278 5:8201880-8201902 AATTATAAGCTACATTTATGAGG - Intergenic
986554791 5:9000296-9000318 AAGTATATGCATCAGGTGTGAGG + Intergenic
986962561 5:13233017-13233039 AATTACATGCTTCAGTTTTAAGG + Intergenic
987673963 5:21050568-21050590 AAAAATATTCTACAGTTTTGTGG + Intergenic
987942602 5:24561366-24561388 AATTATATGAGAAAATTGTGAGG + Intronic
988155728 5:27447351-27447373 AGTTTTTTGTTACAGTTGTGTGG + Intergenic
988339698 5:29954304-29954326 AATTAAATACTACTGTTGTTTGG - Intergenic
989444665 5:41513177-41513199 ACTTCTATGCTGCAGTTTTGAGG + Intergenic
989687087 5:44102629-44102651 AAACATATTCTGCAGTTGTGTGG - Intergenic
989985615 5:50693775-50693797 AATTATATGATTGAGTTATGTGG + Intronic
990707450 5:58545706-58545728 AATTATCTGATAAACTTGTGAGG - Intronic
992389562 5:76317825-76317847 AATTAAGTGCTACATTTTTGAGG - Intronic
992451736 5:76882132-76882154 AATTATATGCGTCAGGTGTGAGG + Intronic
993269244 5:85772616-85772638 ATTTATATGCTGCAGTTGTTGGG + Intergenic
993446824 5:88023269-88023291 AATTATATGTCACAGTGGTTTGG + Intergenic
994496772 5:100522571-100522593 ATGTATATTCTACAGTTGTTGGG - Intergenic
994775899 5:104035358-104035380 AAGTATATGCGTCAGGTGTGAGG - Intergenic
994820414 5:104643472-104643494 AATTCTTTGCTTCAGTTGTCTGG - Intergenic
994887573 5:105583995-105584017 ACGTATATTCTACAGTTGTTGGG - Intergenic
995173694 5:109148552-109148574 AATGATTTCCTAGAGTTGTGTGG + Intronic
995296895 5:110533582-110533604 AAGTATATGCATCAGGTGTGAGG - Intronic
996326785 5:122284248-122284270 AAGTATATTCTGCAGTTGTTGGG + Intergenic
996510122 5:124307537-124307559 AAGTATATGCATCAGGTGTGAGG - Intergenic
996574763 5:124968572-124968594 AAATATATGCGTCAGGTGTGAGG + Intergenic
996608791 5:125355261-125355283 ATGTATATTCTACAGTTGTTGGG + Intergenic
996616097 5:125442613-125442635 ATGTATATTCTACAGTTGTTAGG - Intergenic
996678576 5:126204689-126204711 AAGTATATTCTGCAGTTGTTGGG - Intergenic
996723090 5:126648828-126648850 AAGTATATGCATCAGGTGTGAGG - Intergenic
996917888 5:128733078-128733100 AAGTATATGCGTCAGGTGTGAGG - Intronic
997157588 5:131575987-131576009 AAGTATATGCTTCAAGTGTGAGG - Intronic
997610857 5:135214854-135214876 AATTAAATGCTAGAGTGGGGAGG + Intronic
997798900 5:136840232-136840254 CATGATATGATACATTTGTGGGG - Intergenic
1001867543 5:175118235-175118257 AATTCTATTCTAAATTTGTGAGG + Intergenic
1002462538 5:179382058-179382080 AACCATAGGCCACAGTTGTGAGG - Intergenic
1003362540 6:5442326-5442348 AATTATATTCTTCAGGTTTGTGG + Intronic
1004152007 6:13129834-13129856 ATGTATATTCTACAGTTGTTGGG - Intronic
1005639149 6:27778003-27778025 AATTACCTTCCACAGTTGTGGGG + Intergenic
1006327327 6:33364517-33364539 CATTATATGCTACAACGGTGAGG - Intergenic
1006464998 6:34188136-34188158 AAAGATATGCTAAAGTTTTGGGG - Intergenic
1007084473 6:39133708-39133730 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1008856471 6:56094238-56094260 AATGATGTCCTGCAGTTGTGTGG - Intronic
1009359574 6:62795254-62795276 AAGTATATGCATCAGGTGTGAGG - Intergenic
1009464609 6:63954002-63954024 AAGTATATGCATCAGGTGTGAGG - Intronic
1009844269 6:69116096-69116118 ATTTCTATGTTACAGTTGTCAGG + Intronic
1009949211 6:70376174-70376196 AAGTACATGCTGCAGTTATGGGG + Intergenic
1010305224 6:74312630-74312652 AATAATATCCTAGAGTTCTGTGG + Intergenic
1010841078 6:80649726-80649748 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1012061141 6:94483026-94483048 AATTATTTTCTACCGTTCTGTGG + Intergenic
1012675315 6:102105702-102105724 AATTATATGCGTCAGGTATGAGG - Intergenic
1014115067 6:117661303-117661325 AAATATATGCATCAGGTGTGAGG + Intergenic
1014235252 6:118946972-118946994 AAGTATATTCTGCAGTTGTTGGG - Intergenic
1014301496 6:119687746-119687768 AATTATGTGCTACTTTTTTGGGG + Intergenic
1016609528 6:145972850-145972872 AATTATATACTATTATTGTGTGG - Intergenic
1016819734 6:148336030-148336052 ACTTATTTGATACAGTTGTGAGG - Intronic
1017532166 6:155305974-155305996 ATTTATATGGTTCAGATGTGAGG - Intronic
1017715396 6:157207470-157207492 AATTCTATGCTACATTAGTTAGG + Exonic
1018781561 6:167071967-167071989 ATGTATATTCTACAGTTGTTGGG + Intergenic
1020540881 7:9460300-9460322 AAATATATGCATCAGGTGTGAGG + Intergenic
1021172939 7:17417834-17417856 AAATATATGCATCAGGTGTGAGG - Intergenic
1021531011 7:21645138-21645160 AATTAAATGTTACAAATGTGGGG + Intronic
1021810872 7:24400024-24400046 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1022124560 7:27342970-27342992 AATAATATCCTACAGTTGTTAGG + Intergenic
1022259139 7:28687276-28687298 GATGATATGCTTCAGTAGTGAGG + Intronic
1022572537 7:31468785-31468807 AAGTATATGCATCAGGTGTGAGG + Intergenic
1022709329 7:32836321-32836343 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1022866105 7:34422574-34422596 AATTCTATGCTAAAGTTTTTGGG + Intergenic
1024174961 7:46829856-46829878 ATGTATATTCTACAGTTGTTGGG - Intergenic
1025873699 7:65460351-65460373 AATTATTTGCCTCAGTAGTGTGG + Intergenic
1027354625 7:77343274-77343296 AAGTATATGCGTCAGGTGTGAGG - Intronic
1027909584 7:84232519-84232541 AGTTATATTCTTCAGTTGTTGGG - Intronic
1027932657 7:84558262-84558284 ATATATATGCTACTGTTGGGTGG - Intergenic
1028637635 7:93007384-93007406 AATTTTATCCTCCAGTTATGAGG - Intergenic
1029317453 7:99727390-99727412 AAGTATATGCATCAGGTGTGAGG - Intronic
1029680418 7:102104897-102104919 AAAGATATTCTACATTTGTGAGG + Intronic
1030265567 7:107617188-107617210 AATTATATGCTAAGGTTCTTTGG + Intronic
1030441433 7:109593791-109593813 AAGTATATGCATCAGGTGTGAGG + Intergenic
1030445589 7:109644293-109644315 AAGTATATGCATCAGGTGTGAGG + Intergenic
1030956440 7:115857881-115857903 ATTTATTTGATACAGTTGAGGGG - Intergenic
1031140151 7:117933565-117933587 AATTGTGTTCTATAGTTGTGTGG - Intergenic
1031422192 7:121565574-121565596 AAGTATATGCATCAGGTGTGAGG + Intergenic
1031689977 7:124775974-124775996 AATGATATGTTATAGGTGTGTGG + Intergenic
1031777593 7:125921531-125921553 AAGTATATGCATCAGGTGTGAGG - Intergenic
1036144100 8:6237070-6237092 AATTAAAGGCTGCAGTTTTGGGG - Intergenic
1036472114 8:9061403-9061425 AAGTATATGCATCAGGTGTGAGG + Intronic
1036525746 8:9532917-9532939 AATCATAAGCTACCTTTGTGCGG + Intergenic
1037422280 8:18715807-18715829 ACTTATTTGCTACAGTTTTTTGG - Intronic
1037642410 8:20758651-20758673 ATTTATTTCTTACAGTTGTGGGG + Intergenic
1038164808 8:25075157-25075179 CAGTATTTGCTACAGATGTGTGG - Intergenic
1039763659 8:40605626-40605648 ATGTATATTCTACAGTTGTTGGG + Intronic
1040648271 8:49423486-49423508 AAGTATATGCATCAGGTGTGAGG - Intergenic
1041651583 8:60308246-60308268 AAGTATATGCATCAGGTGTGAGG + Intergenic
1041917273 8:63150078-63150100 AAGTATATGCATCAGGTGTGAGG + Intergenic
1042644704 8:70973925-70973947 ATGTATATGCTGCAGTTGTTGGG + Intergenic
1042994689 8:74683408-74683430 AACTATATAATACAGATGTGAGG + Intronic
1043003666 8:74791395-74791417 ATTTCTATGTTGCAGTTGTGAGG + Intronic
1043329574 8:79098494-79098516 AATAATATGCAACAGAAGTGTGG + Intergenic
1044195299 8:89369291-89369313 ACTTATCAGGTACAGTTGTGTGG - Intergenic
1044614984 8:94130719-94130741 AGTTACATTCTGCAGTTGTGTGG - Exonic
1045219229 8:100181008-100181030 CATTATATGCTACATTAGTGGGG - Intronic
1045671254 8:104555839-104555861 ATGTATATTCTACAGTTGTTGGG - Intronic
1046028870 8:108759229-108759251 AATTATCTGTAACAGTTGTGAGG + Intronic
1046294343 8:112199571-112199593 AATTATATGCGTCAGGTGGGAGG - Intergenic
1047148048 8:122228036-122228058 ATGTATATTCTACAGTTGTTGGG - Intergenic
1048097818 8:131313942-131313964 AAGTATATGCATCAGGTGTGAGG - Intergenic
1048135715 8:131744681-131744703 AAGTATATGCATCAGGTGTGAGG - Intergenic
1048763987 8:137826572-137826594 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1049067079 8:140324887-140324909 ACTTATATTCTGCAGTTGAGGGG - Intronic
1049092550 8:140527297-140527319 TATTATGTGTTAAAGTTGTGTGG - Intergenic
1050896303 9:10888521-10888543 AAGTATATGCATCAGGTGTGAGG - Intergenic
1051036481 9:12753005-12753027 AATTAAAATCTACAGTTGTTTGG + Intergenic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1051926046 9:22327441-22327463 AAATATAAGCCACAGTTCTGAGG - Intergenic
1052550043 9:29936670-29936692 ATGTATATTCTACAGTTGTCAGG + Intergenic
1053783436 9:41633443-41633465 AAGTATATGCATCAGGTGTGAGG + Intergenic
1054666142 9:67737227-67737249 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1054807225 9:69406503-69406525 AAGTATATGCAACAGGTGTGAGG + Intergenic
1055204044 9:73705878-73705900 ATTTATAGGGTACAGTTCTGTGG - Intergenic
1058513190 9:105741601-105741623 AATTGTTTGCCACAGTTGTGTGG + Intronic
1058612651 9:106792303-106792325 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1059268017 9:113054024-113054046 AAGTATAGGCAACAGTTATGAGG - Intronic
1059659317 9:116385894-116385916 AATTAAATGCAATAGTTGTGTGG - Intronic
1185926987 X:4158142-4158164 AACTATATGATATAGATGTGTGG + Intergenic
1186112630 X:6274148-6274170 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1186850426 X:13574514-13574536 AATTATATTCTAAGGTAGTGGGG - Intronic
1187086299 X:16046653-16046675 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1187563936 X:20429452-20429474 AATTTGATGCTACAGGTGAGGGG - Intergenic
1188300769 X:28504031-28504053 AAGTATATGCATCAGGTGTGAGG - Intergenic
1188301995 X:28515842-28515864 AATTATATTCTACCTTTGAGGGG + Intergenic
1188711765 X:33409681-33409703 AATTATATCCTGCATTTTTGTGG - Intergenic
1189452640 X:41152573-41152595 AAGATTATGCTACAGTTGTAAGG - Intronic
1193218624 X:78896276-78896298 ATGTATATTCTACAGTTGTTGGG + Intergenic
1193537339 X:82730796-82730818 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1193617440 X:83707300-83707322 AATTATATTCTGCAGTTCTTGGG + Intergenic
1194308318 X:92275030-92275052 AAGTATATGCGTCAGTTATGAGG + Intronic
1195290895 X:103431297-103431319 AAGTATATGCGTCAGGTGTGAGG + Intergenic
1195841712 X:109182167-109182189 AAGTATATGCATCAGGTGTGAGG - Intergenic
1196497090 X:116334576-116334598 AAGTATATGCGTCAGGTGTGAGG - Intergenic
1196572718 X:117282893-117282915 AAGTATATGCATCAGGTGTGAGG - Intergenic
1197575830 X:128210204-128210226 ATTTATATTCTGCAGTTGTTTGG - Intergenic
1198664961 X:139010330-139010352 ATGTATATTCTACAGTTGTTGGG - Intronic
1198836621 X:140812441-140812463 ATGTATATTCTACAGTTGTTGGG + Intergenic
1199300395 X:146206724-146206746 AATTATGTACTACAGTTTTGTGG - Intergenic
1199364836 X:146969044-146969066 AGTAATTAGCTACAGTTGTGAGG - Intergenic
1201234024 Y:11892878-11892900 AAGTATATGCATCAGGTGTGAGG + Intergenic
1201307265 Y:12561709-12561731 AAGTATATGCATCAGGTGTGAGG + Intergenic
1202076262 Y:21040677-21040699 AAGTATATGCATCAGGTGTGAGG + Intergenic