ID: 1133919759

View in Genome Browser
Species Human (GRCh38)
Location 16:10141519-10141541
Sequence ATGAATACAGAGAAGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 522}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133919758_1133919759 15 Left 1133919758 16:10141481-10141503 CCATCTAAAAAAATGAAATAAAA 0: 1
1: 47
2: 1001
3: 7173
4: 111780
Right 1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG 0: 1
1: 0
2: 4
3: 58
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133919759 Original CRISPR ATGAATACAGAGAAGAATCA AGG Intronic
901802871 1:11719372-11719394 AGGAGAACAGAGAAGACTCAGGG - Intronic
902913881 1:19623971-19623993 ATTAATAAAAAGCAGAATCATGG - Intronic
903432992 1:23323015-23323037 TTAAAGACAGAGAAGACTCAAGG + Intronic
904585285 1:31576628-31576650 GTGTAGACAGAGAAGAAACAGGG + Intronic
905870843 1:41403737-41403759 ATGAATACAAACAAGAGACAGGG - Intergenic
906765426 1:48426672-48426694 ATGAACAAAGAAAAGGATCAAGG + Intronic
906874146 1:49517508-49517530 ATGAAGACAAAGGAGAATGAGGG + Intronic
906967500 1:50472888-50472910 GAGAATTCAGAGAAGAATGAAGG + Intronic
907688508 1:56638024-56638046 ATGAATACAGAGATGAAAGTGGG - Intronic
907786677 1:57619670-57619692 ATGATTACAGACATGAGTCAGGG + Intronic
907821806 1:57977336-57977358 ATGAAGACAGGGATTAATCAGGG - Intronic
907950865 1:59182398-59182420 ATTAATACACAGAAAAATTAAGG + Intergenic
908598723 1:65716070-65716092 TTGTATACAGAGAAGGATAAGGG + Intergenic
908800748 1:67877885-67877907 ATGAATTCAGAGAACATTCCAGG + Intergenic
909288351 1:73849990-73850012 GTTAATACAGAGAAGAACAATGG + Intergenic
909320946 1:74285073-74285095 ATGAATTCAGAGAACAGTGAAGG - Intronic
909330448 1:74403219-74403241 CTAAATACAGTGAAGAATTAAGG - Intronic
909481336 1:76131210-76131232 ATAAATCCAGATAAGATTCAAGG - Intronic
909644746 1:77904646-77904668 ATGCGTACAGAGGAAAATCAGGG + Intronic
909664683 1:78120218-78120240 ATGAGAACAGAGAAGAAATACGG - Intronic
909754263 1:79203797-79203819 ATGTCTAAAGAGAAGGATCAGGG + Intergenic
909991483 1:82227844-82227866 AGGAAGACAGAGAAGAACAAAGG - Intergenic
910510116 1:87994047-87994069 ATGAAAAAAGAGAAGAATCGAGG + Intergenic
911620040 1:100056193-100056215 ATGGAGACAGAGCAGAATGATGG - Intronic
912620251 1:111149055-111149077 ATGAAAACAGAAAAGAATAGAGG - Intronic
913094785 1:115506157-115506179 ATGTGTAGAGAGAAGAGTCAGGG + Intergenic
913360166 1:117971733-117971755 ATGAATAATGTGAAGATTCAAGG + Intronic
914577431 1:148987709-148987731 ATGACTACAGAGTAGAATTGGGG + Intronic
915177849 1:154031558-154031580 ATGGAGACAGAGTAGAATGATGG - Intronic
915573681 1:156760744-156760766 ATGAAGTCAGAGCAGGATCAGGG - Intronic
917982304 1:180277797-180277819 ATGAATACTGTGAAACATCAGGG + Exonic
918119213 1:181522956-181522978 ATGAAAACAGGGAAGGATTAGGG - Intronic
918695201 1:187537486-187537508 ATTAATATAGAGAAAAAGCAGGG - Intergenic
918871008 1:189974952-189974974 ATGGATATAGAGCAGAATGATGG - Intergenic
919525662 1:198646817-198646839 AAAAGTAAAGAGAAGAATCAAGG + Intronic
921775248 1:219090582-219090604 AGGAATACAGGGAAGAAGGAAGG + Intergenic
923821745 1:237450925-237450947 ATAAATATAGAAAAGAAACAAGG - Intronic
924308655 1:242718116-242718138 ATGAAGAAAGAGGAGAAGCAAGG + Intergenic
1063013571 10:2051050-2051072 TTGAGTACAGGGAAGAATCCAGG - Intergenic
1063680986 10:8187869-8187891 ATGAAGACAGAGGTGAAACAGGG + Intergenic
1064342050 10:14496099-14496121 ATAAATGCAGAGAAGAAAAAAGG - Intergenic
1064585747 10:16837798-16837820 ATGAATACAGGAAACAATCAAGG - Intronic
1064619291 10:17198604-17198626 ATAAAGACAAAGCAGAATCAAGG + Intronic
1064770876 10:18721607-18721629 ATGAATACAGAAAAGTAGGAAGG - Intergenic
1064951270 10:20853695-20853717 ATGAAGACAGAGTAGAATGATGG + Intronic
1065593984 10:27294553-27294575 ATGGTTACAGAGCAGAAGCATGG - Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1066996903 10:42572193-42572215 TTGAATACAGAGAAGAAACGTGG - Intergenic
1067323511 10:45244703-45244725 ATGAATACAGGAAACAATCAAGG - Intergenic
1067734958 10:48843443-48843465 ATGAACACAGAGATGACACATGG + Intronic
1068317181 10:55361394-55361416 TAGACTACAGAGGAGAATCATGG - Intronic
1069215912 10:65820762-65820784 ATGTATACAGAACATAATCAGGG - Intergenic
1070018333 10:72557449-72557471 GTGGATACAGTGAAAAATCAAGG + Intronic
1071313613 10:84368869-84368891 AGGCATACAGAGAGGAATAATGG - Intronic
1071770104 10:88719702-88719724 ACGAATACAGTGAAGAATTAGGG + Intergenic
1074185277 10:111095824-111095846 ATGAATCCAGTGAAAAATAAAGG + Intergenic
1074619428 10:115103718-115103740 ATGGAGACAGAGTAGAATGATGG - Intronic
1074685729 10:115960916-115960938 ATAAAGACAGAGAAAGATCAAGG + Intergenic
1075340169 10:121641055-121641077 ATGAATACAGACCAGAAGGATGG + Intergenic
1075432142 10:122394767-122394789 GTGAAGAGAGAGAAAAATCAGGG - Intronic
1075502691 10:122990592-122990614 TTGAATAAAGAGAAGAAACTAGG + Intronic
1076125947 10:127974037-127974059 ATGGCTGCAGAGAAGAATAAGGG - Intronic
1077828716 11:5839389-5839411 ATGGAGACAGAGTAGAATGATGG + Intronic
1079820453 11:25120922-25120944 ATAAATACAGAGAAAATTAATGG - Intergenic
1080300039 11:30773978-30774000 ATGAATATACAGAAGAGCCAAGG - Intergenic
1080964593 11:37199553-37199575 ATGGATACAGACAGAAATCAAGG + Intergenic
1081261484 11:40966698-40966720 ATCAATGAAGAGAAAAATCAAGG - Intronic
1081347900 11:42012828-42012850 AGGAACACAGAGAACAATCAGGG + Intergenic
1082045743 11:47724781-47724803 ATGAAAACAGGTAAGAGTCAGGG + Intronic
1082771705 11:57213034-57213056 ATGGGGAGAGAGAAGAATCAGGG + Intergenic
1082928210 11:58573758-58573780 AAGACTACAGAGAAGAATTATGG - Intronic
1082952686 11:58834264-58834286 AAGAATACAGAGGAGAAGGAAGG + Exonic
1086227350 11:84528048-84528070 ATGAATCAAGAGAATAATCTAGG + Intronic
1087296653 11:96384993-96385015 AGGGATACATAGAAAAATCATGG + Intronic
1087574914 11:99977554-99977576 ATGCAGACAGACAAGAAGCAAGG + Intronic
1087711545 11:101559303-101559325 ATGAATACAGTGTAAAATTAGGG - Intronic
1087886294 11:103487027-103487049 AATAATACAGTGAAGAATGAGGG - Intergenic
1088063264 11:105683138-105683160 ATGTATACAGAGAAAAATCATGG - Intronic
1088193561 11:107252205-107252227 ATGAATACAGAAAACATTGATGG - Intergenic
1090173595 11:124626626-124626648 ATATATAGAGAGGAGAATCAGGG + Intronic
1090448778 11:126787877-126787899 ATGAATGCCAAGAAGAAGCAGGG - Intronic
1091516758 12:1191937-1191959 CTGAATAAACAGTAGAATCATGG + Intronic
1091548018 12:1517393-1517415 AGGAAAACAGAGAAAAATGAAGG + Intergenic
1091566179 12:1649856-1649878 ATGATTAAAGAGAGGAAGCAGGG - Intergenic
1091918858 12:4288570-4288592 ATGAATGCACAGAGGATTCAAGG - Intronic
1092829599 12:12430906-12430928 ATGAACAAAGAAAAGAATGAGGG - Intronic
1092923217 12:13250868-13250890 ATGGCTAGAGAGAAGAATGAAGG + Intergenic
1093152300 12:15636962-15636984 ATTAATACAGAGAAAAACTATGG + Intronic
1093194056 12:16109399-16109421 ATGAATAGAGAGAAGAGATAAGG + Intergenic
1094106877 12:26822318-26822340 ATGAATGCAGGGAAGACTAAAGG - Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095048342 12:37534513-37534535 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1095247534 12:39940339-39940361 ATAAATGTAGAGAAGAATAAAGG - Intronic
1097436928 12:59561422-59561444 ATGAGTACAGAGAAGAAATTTGG - Intergenic
1097445963 12:59670942-59670964 ATGAAGAGAGAGGAGACTCATGG - Intronic
1097452151 12:59749933-59749955 AAGAACACATAGAAGAAGCAGGG + Intronic
1097835673 12:64270535-64270557 ATAACTACAGAGAAGAATTCAGG - Exonic
1097901995 12:64882535-64882557 ATGAATACACAGCAGTATGAGGG - Intergenic
1098073163 12:66698006-66698028 TTAAATACAGAAAAGAATTACGG + Intronic
1098196860 12:68011511-68011533 ATGAATAGAAAGAAGGACCATGG + Intergenic
1098537250 12:71606937-71606959 CTCAATACAGAGAAGAGTAAAGG - Intergenic
1098648138 12:72931544-72931566 ATGATGACAGAGTAGAATGATGG - Intergenic
1098862061 12:75721353-75721375 ATGAATTGAGAGAATATTCAGGG + Intergenic
1099084640 12:78230378-78230400 ATGCATTCAAAGAAGAAACAGGG + Intergenic
1099635003 12:85202604-85202626 TTGTAAACAGAGAAAAATCAGGG - Intronic
1099725074 12:86415445-86415467 ATGAATACACAGGAGTATCATGG + Intronic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100506947 12:95230762-95230784 ATGAATGCAGAGCAGAAGCAAGG - Intronic
1100871909 12:98918366-98918388 ATGAATACACAGAAGATACAAGG + Intronic
1103031439 12:117616858-117616880 AAGAATAAAAAGATGAATCATGG - Intronic
1104137360 12:125953209-125953231 ATGATGACAGAGAAAAATAAGGG - Intergenic
1105236512 13:18560404-18560426 ATGATGACTGAGAATAATCAGGG + Intergenic
1105791478 13:23804143-23804165 ATGATTACAGAGAAGAAATCTGG + Intronic
1106041665 13:26099484-26099506 ATGAAGACAGATAATAAGCAAGG + Intergenic
1106096784 13:26653235-26653257 AATAATACAGAGAAGAAAGAAGG - Intronic
1107367361 13:39697166-39697188 AATAATACAGAGAGAAATCAGGG + Intronic
1109033698 13:57228567-57228589 TTGAACACAGAGAAAAATCCTGG + Intergenic
1109128078 13:58543819-58543841 ATGACTACAGAGAACAAGGAAGG + Intergenic
1109335137 13:60984648-60984670 GTGATTACAGAAAAGGATCATGG + Intergenic
1109664048 13:65506442-65506464 ATAAATACAGGGAAATATCAGGG - Intergenic
1109731128 13:66415595-66415617 AGGAAGACAGAGAAGGATAAGGG - Intronic
1110004067 13:70243452-70243474 ATGAATACAAAGAATAGTCAAGG + Intergenic
1110104827 13:71659156-71659178 ATGAATACTGAGAGGAAACAAGG + Intronic
1110517124 13:76427041-76427063 ATGAAGACAGAGATAAACCAAGG - Intergenic
1110666021 13:78118391-78118413 ATGAAAACAAAGAAGAGTTAAGG + Intergenic
1110823671 13:79946444-79946466 ATGAACATATAGAAAAATCAGGG - Intergenic
1110970575 13:81756367-81756389 ATTATTACAGCTAAGAATCAGGG - Intergenic
1111055995 13:82952456-82952478 ATGGAGACAGAGTAGAAGCAGGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112926532 13:104682056-104682078 ATGAATCCAGACAAGATTAAGGG + Intergenic
1113070199 13:106412783-106412805 AGGAATGAAGAGAAGAATGAGGG - Intergenic
1113237929 13:108302328-108302350 ATGAATAAAAAGAAGATTGAGGG - Intronic
1113272387 13:108687517-108687539 ATGAATGCAGAGCAGAACCCAGG - Intronic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114819216 14:25996301-25996323 ATGAAAACATAGAAGAATGAAGG - Intergenic
1116163641 14:41304852-41304874 AAGAAAACAGAGAAGCATCCAGG + Intergenic
1116562819 14:46402799-46402821 CAGAATTCAGAGAATAATCATGG + Intergenic
1117654641 14:57942348-57942370 ATGAATTCAGCCTAGAATCAGGG - Intronic
1117821765 14:59657586-59657608 ATGGAGAGAGAGCAGAATCAGGG + Intronic
1118300441 14:64610641-64610663 AAGAAAACAGACAAGAATAAAGG - Intergenic
1118329840 14:64806643-64806665 ATGAGTGCACAGAAGAATCAAGG - Intronic
1118886555 14:69871741-69871763 ATATATAAAGAGAAGAATTAGGG - Intronic
1119891385 14:78185141-78185163 AGGAATACAGAGAAGAGTAATGG + Intergenic
1119942267 14:78653592-78653614 ATTAATAGATAGAAGATTCATGG - Intronic
1120312930 14:82854436-82854458 ATGAATAAAGAAATAAATCATGG - Intergenic
1120645547 14:87069968-87069990 AGTAAAACAGAGAAGAATAAAGG - Intergenic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1121280539 14:92694347-92694369 AGGAAGACAGTGAAAAATCATGG + Intergenic
1121304502 14:92897592-92897614 CTAAATACAGAAAAGAATCCAGG - Intergenic
1124841723 15:33248302-33248324 GTCAACACAGAGAAGAATCCAGG - Intergenic
1124863828 15:33469906-33469928 AAGAATACAGAGATGAATACGGG + Intronic
1125060735 15:35420115-35420137 ATCAATAAAAGGAAGAATCATGG + Intronic
1125073428 15:35583990-35584012 AAGAAAGCAGAGAAGAATGATGG - Intergenic
1126274961 15:46866610-46866632 ATGCAAACAGATAAGTATCATGG - Intergenic
1126750458 15:51871661-51871683 AAGAAAGCAGAGAAGAATTACGG + Intronic
1126962067 15:54007815-54007837 AGGAATACAGATCAGAATAAGGG + Intergenic
1127171407 15:56306570-56306592 ATGGATATAGAGTAGAATAATGG + Intronic
1127477399 15:59347632-59347654 AGGAATAAAGAAAAGGATCAAGG + Intronic
1127820046 15:62646822-62646844 CTGGGGACAGAGAAGAATCAGGG - Intronic
1128537068 15:68499708-68499730 ATGAGTTCAGAGACGAAGCAGGG + Intergenic
1128605670 15:69035194-69035216 ATGAATCCAGGGAAGCAACAAGG + Intronic
1128828068 15:70739461-70739483 ATGAATAAAGGGATGAATTAAGG + Intronic
1130314879 15:82786717-82786739 ATCAAGACAGAGAAGAACCAAGG + Intronic
1130827257 15:87562076-87562098 GTGAGTAGAGAGAAGAAACATGG - Intergenic
1130851448 15:87798238-87798260 TTGAATACAGGGAAGAAGGAAGG - Intergenic
1131457527 15:92594840-92594862 ATCAATAAAGAAAACAATCACGG + Intergenic
1131699127 15:94914618-94914640 ATGATTAAATAAAAGAATCATGG - Intergenic
1131732990 15:95301731-95301753 ATGAAGACAGAGTAGAATGGTGG + Intergenic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131954132 15:97713411-97713433 AACAATATAGAGAAGACTCATGG - Intergenic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1134908940 16:18006613-18006635 CTGACTACAGAGGAGAATGAGGG - Intergenic
1135092169 16:19525812-19525834 AGGAAGACAGACAAAAATCAAGG + Intronic
1137087722 16:36149017-36149039 AGAAATACAGAGAAGAGTAAGGG + Intergenic
1137934553 16:52622071-52622093 ATGAAAAAATAGAAGAAACAAGG + Intergenic
1138094014 16:54198058-54198080 ATGAAAACATAGAATAAACATGG - Intergenic
1138824157 16:60298623-60298645 AGGAAGACAGAGGAGAATTAAGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139314251 16:66054941-66054963 CTGAGTGCAGTGAAGAATCAAGG + Intergenic
1140905903 16:79408786-79408808 AAGGATACAGAAAAGAATAAGGG + Intergenic
1141404285 16:83778173-83778195 ATGAACTCAGAGAAAAATGAAGG + Intronic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1143054498 17:4152712-4152734 ATGAATAAAGAAAGGAATCAGGG - Intronic
1143182402 17:4991599-4991621 ATGAAGACAGAGAAGATAAAGGG - Intronic
1143444263 17:6997902-6997924 ATGAATCCAGAGATGAGTGAGGG + Intronic
1143735570 17:8909878-8909900 AAGAATACAGAGAGGAGCCACGG + Intronic
1144427050 17:15152979-15153001 ATGGAGCCAGAGAAGAACCAGGG - Intergenic
1144577152 17:16436393-16436415 ACGAATCCAGAGATGAACCAAGG - Intronic
1145353241 17:22109270-22109292 ATGAGTAAATAGAAGAATCAAGG - Intergenic
1145365732 17:22265724-22265746 ATGAAAACAAAGGAAAATCAAGG - Intergenic
1145411608 17:22670693-22670715 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1145728347 17:27154201-27154223 ATGAAAGCAGAGGAAAATCAAGG + Intergenic
1145729130 17:27159152-27159174 ATGAATGCAAAGAAAACTCAAGG + Intergenic
1145826934 17:27884137-27884159 GTTAATACAGAGAAGAATGTGGG - Intronic
1146042015 17:29464771-29464793 ATGAGTACAGTGAAGAACTAAGG - Intronic
1146952717 17:36918088-36918110 ATGAATACAGAGAAAAGAAAAGG - Intergenic
1147533829 17:41304721-41304743 ATGAATACAGACAAGAAGGAGGG - Intergenic
1147679832 17:42234932-42234954 AAGAATGAAGAGAAGAATCTAGG + Intronic
1147914064 17:43876348-43876370 AGGAATGCAGAGAATAATGAAGG + Intronic
1149064332 17:52462728-52462750 ATGAATCCAGATAGGAATGAAGG - Intergenic
1149340896 17:55685336-55685358 ATCAAGACAATGAAGAATCAAGG - Intergenic
1150967115 17:69983763-69983785 ATGTAGACAGAAAAGAATCAAGG + Intergenic
1153590208 18:6665800-6665822 ATGACTACAAAGTACAATCATGG - Intergenic
1154087503 18:11321912-11321934 ATGAAGACAGAGAAAGATCCTGG + Intergenic
1154355039 18:13618611-13618633 ATGGATATAGAGGAAAATCATGG - Intronic
1155518936 18:26649932-26649954 ATTAACACTGAGAAGAAACACGG - Intronic
1155542185 18:26880114-26880136 TTGAATAAAGATAAAAATCACGG + Intergenic
1155580508 18:27299871-27299893 ATGAATACAGAGGAGAAACAAGG + Intergenic
1156212510 18:34960661-34960683 ATGAATTCAGGGAAAAATCTCGG - Intergenic
1156345231 18:36251256-36251278 AGGAATGCAAAGAAGAAACATGG + Exonic
1156641777 18:39109667-39109689 GTGAAGACAGAGAAGAATTGAGG + Intergenic
1157136217 18:45058455-45058477 ATGAGTATAGAAAAGAATTACGG + Intronic
1157756823 18:50226024-50226046 ATAAATACAGAAGAAAATCATGG + Intergenic
1157772461 18:50361253-50361275 ATCAATTCAGAGAACACTCATGG - Intergenic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159409993 18:68060178-68060200 AGGTATACAAAGAAGCATCAGGG - Intergenic
1159446771 18:68550509-68550531 ATGAAGACAGAGTAGAATGATGG + Intergenic
1159446854 18:68551414-68551436 ATGAAGACAGAGTAGAATGACGG - Intergenic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1160591059 18:79944940-79944962 ATCAACACAGAGCAGAAGCAGGG + Intronic
1161336195 19:3714943-3714965 CTGAATGCACAGAAGAATTAAGG + Intronic
1162606013 19:11708630-11708652 GTGAAAAGAGAGAAGAGTCAAGG - Intergenic
1163081421 19:14946017-14946039 ATGGAAACAGAGTAGAATGATGG - Intergenic
1165207517 19:34203196-34203218 AGGATTACAGTGAAGAAACATGG + Intronic
1165293295 19:34906089-34906111 CTGAAGACAGAGAAGATGCAGGG + Intergenic
1166127722 19:40725672-40725694 ATGAATACAGAGCAGAACTAGGG - Intronic
1166206344 19:41272084-41272106 ATGAAGACAGAGATGAAGCAAGG + Exonic
1166276875 19:41760194-41760216 ATGGAATCAGAGTAGAATCATGG - Intronic
1166818853 19:45564141-45564163 AAGAACAAAGAGAAGCATCAGGG + Intronic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
1168703398 19:58454631-58454653 ATGAATACAAAGATAAATGATGG - Intronic
925957292 2:8979486-8979508 AACAAAACAGATAAGAATCACGG - Intronic
926191882 2:10734501-10734523 ATGAATAGAGGGAAGCATCCTGG + Intronic
926553735 2:14332197-14332219 ATGAACAGAGAGAAGAAGAATGG - Intergenic
926848579 2:17169615-17169637 AGGATTACAAAGAATAATCAAGG - Intergenic
926971805 2:18474240-18474262 ACAAATACAGAGAAGAATGGAGG - Intergenic
927550889 2:23998404-23998426 ATAAAAGCAGAGAAGAATAATGG + Intronic
928031776 2:27786156-27786178 AAGAATATAGAGAAAAATGAAGG + Intronic
928083872 2:28333516-28333538 ATGAATTCAGAGCAGAAGCAGGG - Intronic
928784538 2:34866695-34866717 ATTAGTATAGAGATGAATCATGG + Intergenic
928859384 2:35838324-35838346 ATGAATAAGTAGAAGAATAAAGG - Intergenic
928941687 2:36733287-36733309 ATGCACAGAGAGAAGAAGCAGGG - Intronic
928957542 2:36886262-36886284 ATGAACACATAGAATATTCAGGG + Intronic
929239132 2:39635791-39635813 ACAAAAACAGAGTAGAATCATGG + Intergenic
929727263 2:44443636-44443658 ATGAAGCCAGAGAAGAATAAAGG + Intronic
931093174 2:58909389-58909411 AGGAATACATGGAAAAATCATGG - Intergenic
931638005 2:64357935-64357957 ATGAACACAGAGAGGGATCATGG - Intergenic
931905420 2:66837504-66837526 ATGAAGACAGAGTAGAATGATGG - Intergenic
932230097 2:70076094-70076116 ATCAATTCAGAGAATAATCGAGG + Intergenic
933495814 2:83048946-83048968 ATCAATATAGAAAAGAATAATGG - Intergenic
933598628 2:84307326-84307348 CAGAATACAGAGAGGATTCAGGG - Intergenic
933638114 2:84729211-84729233 AAGAATACTGAGAGGAATAAGGG - Intronic
933945866 2:87285776-87285798 AATAAAACAGAGAAGAAACAGGG + Intergenic
934528346 2:95067493-95067515 ATGAATTCAGCGAAGTAGCAGGG - Intergenic
934955654 2:98615833-98615855 ATGAAGCCAGAAAAGAAACAGGG - Intronic
935247746 2:101233931-101233953 ATGAAGTCAGAAAAGATTCATGG - Intronic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
936334346 2:111575810-111575832 AATAAAACAGAGAAGAAACAGGG - Intergenic
936716976 2:115198282-115198304 ATGAATCCAGAAAAGTACCAGGG - Intronic
936802065 2:116282324-116282346 ATGATTTCAGTAAAGAATCAGGG + Intergenic
936852664 2:116919857-116919879 TTGAATTCAGAGTAGAATCCTGG + Intergenic
937062945 2:118993634-118993656 AAGAACAGAGAGAAGATTCAGGG + Intronic
937383971 2:121408859-121408881 ATGAATAAAGACAACAATGATGG + Intronic
938276470 2:130029627-130029649 TTAAAGAAAGAGAAGAATCAAGG - Intergenic
938327427 2:130420385-130420407 TTAAAGAGAGAGAAGAATCAAGG - Intergenic
938362514 2:130701092-130701114 TTAAAGAGAGAGAAGAATCAAGG + Intergenic
938438902 2:131307732-131307754 TTAAAGAAAGAGAAGAATCAAGG + Intronic
939212162 2:139189974-139189996 GAGAATACAGAGTATAATCAAGG + Intergenic
939276590 2:140005573-140005595 ATGGAGATAGAGAAGAATGATGG + Intergenic
940619355 2:156091588-156091610 ATGATTACAAAGATGAATCATGG - Intergenic
940647632 2:156408275-156408297 ATTAATGCGGAGAAGAATCTTGG - Intergenic
941442792 2:165558888-165558910 ATTAATAATGAGAATAATCATGG - Intronic
941477753 2:165969280-165969302 ATGAATAAAGAGAAGAAATTTGG + Intergenic
941540489 2:166776975-166776997 ATGTATATAGAGAAGAGGCAGGG + Intergenic
941913149 2:170786380-170786402 ATGAATAAAGATAAGAACAACGG - Intronic
943164217 2:184297260-184297282 ATGAATACAAACAAGGCTCAGGG + Intergenic
943202758 2:184850031-184850053 ATGAAGATAGAGTAGAATGATGG + Intronic
943556530 2:189412819-189412841 ATCAAAACATAGAAAAATCAAGG + Intergenic
944274238 2:197817997-197818019 AAGATTCCTGAGAAGAATCAAGG + Intronic
944726019 2:202471878-202471900 ACCAATACACAGTAGAATCATGG - Intronic
945214209 2:207415844-207415866 ATCCATACAGTGAAAAATCAAGG + Intergenic
945326147 2:208485080-208485102 ATGTATACAGAAAAGAGTGAAGG + Intronic
945431390 2:209770258-209770280 ATGAAAAGAGAAAAGAATCATGG - Intergenic
945541405 2:211091996-211092018 ATGGATACAGGGAAGAATTTGGG - Intergenic
945822007 2:214675648-214675670 ATGAGTACAGCGAAGTGTCAAGG + Intergenic
946102052 2:217333915-217333937 AGGAATGAAGAGAAGAAGCAAGG + Intronic
947848118 2:233262141-233262163 ATGAAGACAGATAGGAGTCAAGG - Intronic
947880147 2:233501667-233501689 AGTAAGAAAGAGAAGAATCAAGG + Intronic
1168856352 20:1011943-1011965 ATGAATACAAATAATAATGATGG - Intergenic
1169247955 20:4038688-4038710 ATGCATACAGTGAACAAACAAGG + Intergenic
1169282401 20:4278719-4278741 ATTAATATAAAGAAGAAGCAGGG - Intergenic
1169719378 20:8657102-8657124 AAGAAGACAGAGAAAAAACAGGG + Intronic
1170194758 20:13678399-13678421 TGAAATAAAGAGAAGAATCAAGG - Intergenic
1171040726 20:21760388-21760410 ATGAAAACAGAGAGGAAAGAAGG - Intergenic
1171542880 20:25977990-25978012 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1171563487 20:26153466-26153488 ATGAGTAAATAGAAGAATCGAGG - Intergenic
1171778715 20:29397321-29397343 AAGAAAAGAGAGAAGATTCAAGG + Intergenic
1172196992 20:33098768-33098790 AGGAATGCAGAGGAGAAACATGG - Intronic
1172334010 20:34098999-34099021 AAGAATAAAGAGATGAATGAGGG - Intronic
1173024660 20:39296674-39296696 CTGCATACAAAGAATAATCATGG + Intergenic
1173393524 20:42656479-42656501 AGGAAAACAGAGAAGAATAAAGG + Intronic
1173474092 20:43346340-43346362 ATGAAGAGATAGAAGCATCAAGG - Intergenic
1173529082 20:43754728-43754750 ATGAGCCCAGAGAAGAACCAGGG - Intergenic
1174748409 20:53087162-53087184 ATGAATGGAGAGAAGAATTGAGG + Intronic
1174886814 20:54344855-54344877 AAGAATACATAGAAACATCAGGG + Intergenic
1175014645 20:55776514-55776536 ATGAAGTCAGAAAAGAATCCTGG - Intergenic
1175174234 20:57101025-57101047 ATGAAGAGAAAGAAGAATCAGGG + Intergenic
1175177666 20:57122648-57122670 ATGATCACAAAGAAGAAACAAGG + Intergenic
1176780502 21:13188689-13188711 ATGATGACTGAGAATAATCAGGG + Intergenic
1178792919 21:35716645-35716667 TTGAATACAGAGAAAGGTCAGGG - Intronic
1178967488 21:37135563-37135585 ATGAATGCAGAAGAGAACCAAGG + Intronic
1179369918 21:40795671-40795693 ACAAATTCAGAGAATAATCAGGG + Intronic
1179623717 21:42635255-42635277 ATGGATGGAGAGAAGAATGATGG - Intergenic
1181364272 22:22363142-22363164 AATAATACAAAGAAGAATTAGGG - Intergenic
1182588150 22:31358449-31358471 ATAAATAAAAAGAAGAATCGGGG + Intergenic
949243527 3:1898574-1898596 GTCCATTCAGAGAAGAATCAGGG + Intergenic
949277412 3:2301064-2301086 ATGGATTCAAAGAAGGATCAAGG - Intronic
949828641 3:8189807-8189829 ATGGATACAGAGTAGAATGACGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
952172443 3:30823054-30823076 CTGAATACAGCCAAGAATCCTGG + Intronic
952589708 3:34936185-34936207 ATTAATACATAGAATATTCAGGG + Intergenic
952621368 3:35347171-35347193 AGGAATACACAAAAGAAACAAGG - Intergenic
952669253 3:35946653-35946675 ATGAAGCCAGAAAGGAATCAGGG + Intergenic
952682526 3:36111004-36111026 AGCAATTCAGAGAAGAATCCAGG - Intergenic
952734060 3:36670636-36670658 ATGAATACAGTAAAGTTTCAGGG + Intergenic
952740718 3:36731644-36731666 ATGAGGAAAGAGAAGACTCAAGG - Intronic
953043210 3:39273190-39273212 ACGAATTCAGAGATGCATCATGG - Intronic
953206016 3:40829960-40829982 ATGAAAACAAATAAAAATCAGGG + Intergenic
953712122 3:45282658-45282680 ATGAAGACAGAGTAGATCCATGG + Intergenic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955993666 3:64655692-64655714 CTAAATACAGAGAAGAATTATGG + Intronic
956089826 3:65654206-65654228 CTGCAAACTGAGAAGAATCAGGG - Intronic
956666646 3:71648742-71648764 GTGTATACAAATAAGAATCATGG + Intergenic
958025381 3:88042689-88042711 GTGAATCCTGAGAAGACTCATGG + Intergenic
958045836 3:88282594-88282616 GTGAACTCAGAGAAGCATCAGGG + Intergenic
959274109 3:104255647-104255669 AGGACCACAGAGAAGTATCAGGG - Intergenic
959928349 3:111950860-111950882 ATGTATACAAGGAAGAAACAAGG + Intronic
960542525 3:118877359-118877381 AATAATACAGAGTAGAATAATGG - Intergenic
961247833 3:125472015-125472037 AGGCTTACAGAGAAGAAACAGGG - Intronic
961701041 3:128744834-128744856 GTGACTTCAGAGAAGTATCAAGG - Intronic
962480391 3:135793017-135793039 ATGATTACAGAGATAACTCATGG - Intergenic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
963370210 3:144389670-144389692 ATGCAAACAGAGAAGCATGAAGG - Intergenic
964088272 3:152844750-152844772 ATGTAGACAGAGAAGAAAAAAGG + Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964793210 3:160471970-160471992 ATAAATGAAGAGAAGAATCTGGG - Intronic
964816925 3:160727648-160727670 ATAAATATAGAGCAGAGTCAGGG + Intergenic
964888169 3:161508576-161508598 ATGAAGACAGAGAGGACACATGG - Intergenic
965216119 3:165867003-165867025 CTGAAAACAGTGAAAAATCATGG - Intergenic
965482491 3:169236432-169236454 ATGAATACATAAATGAATAAGGG + Intronic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
965925826 3:173978491-173978513 ATGAAAACAAAGAAGGATAAGGG + Intronic
966313343 3:178618419-178618441 GTGAAGACAGAGAAGGATTAGGG - Intronic
967043374 3:185714847-185714869 CTGAATACTGAGAAAAAGCAAGG - Intronic
968885790 4:3331317-3331339 ATGAAAACTGGGAAGAATCCAGG + Intronic
969155008 4:5202533-5202555 ATCAATGCAGAGAAGAAACATGG - Intronic
969273202 4:6116787-6116809 ATGAATACATAAAACAATGATGG + Intronic
970158110 4:13161774-13161796 ATGAAGTCAGATAAGAAACATGG + Intergenic
970981100 4:22098366-22098388 ATGAATATAAAGAAAAATTAAGG + Intergenic
971192372 4:24439833-24439855 ATGAATGCACAGTAAAATCATGG - Intergenic
971579714 4:28320127-28320149 ATGAATTCAGAAAAGTTTCAGGG + Intergenic
971717353 4:30196076-30196098 AATAAGAAAGAGAAGAATCAAGG - Intergenic
971717573 4:30199138-30199160 GCAAATACAGAGAAGAATCATGG - Intergenic
971718596 4:30214904-30214926 CTGAAAACAGAAATGAATCATGG + Intergenic
971919493 4:32918513-32918535 ATGAACACACAGAAAAATCAAGG - Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972269857 4:37500936-37500958 ATGAAAACAGAAAAAAATAAGGG - Intronic
974130234 4:57745617-57745639 AAGAAAGGAGAGAAGAATCAAGG - Intergenic
974155387 4:58065041-58065063 TGGAAAACAGAGAAAAATCAGGG + Intergenic
974453647 4:62098000-62098022 ATGAATTCAGAGAGGAAGCTGGG - Intergenic
975618059 4:76267250-76267272 ATGAATAAAGAGTAGCTTCAGGG + Intronic
976406661 4:84667046-84667068 ATGGAGACAGAGTAGAATGATGG + Intergenic
976847293 4:89504234-89504256 ATGAATTCACAGAAAAGTCAGGG + Intergenic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977431379 4:96934357-96934379 GTGAATAGAGAAAAGAATCATGG - Intergenic
978220269 4:106264107-106264129 ATGAATACAGATAAGAAGTTTGG - Intronic
978229431 4:106380980-106381002 AGAAATACAGAGTAGAATGATGG + Intergenic
978972164 4:114821746-114821768 AGGAACACAGTGAACAATCAGGG - Intergenic
981504580 4:145484845-145484867 ATCAATACAGTGAAAATTCAGGG - Intronic
981583889 4:146278838-146278860 AGGAATCCAGACTAGAATCAGGG + Intronic
981716821 4:147760139-147760161 CTGAATACAGGGAAGCAGCAAGG - Intronic
982023868 4:151232764-151232786 CTGAAGAGAGAGAGGAATCAGGG - Intronic
982340339 4:154291762-154291784 AGAAATACAGAGAAGAAGGATGG + Intronic
982516091 4:156352049-156352071 AAGAAAAAAGGGAAGAATCACGG - Intergenic
982649280 4:158066299-158066321 AGCAATACAGAGAAAAAACAGGG - Intergenic
982921937 4:161286765-161286787 ATTAAAAGAGAGAAAAATCAAGG - Intergenic
983111208 4:163751872-163751894 ATAAAGACAAAGAAGAGTCAAGG + Intronic
983607249 4:169602075-169602097 GTAAAGAAAGAGAAGAATCAAGG - Exonic
983630695 4:169846333-169846355 ATAAATACAAAGATGAATGAGGG - Intergenic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984243652 4:177248359-177248381 ATGTATACAGAGAAGAGTGAGGG + Intronic
984322516 4:178211631-178211653 ATGATGACAGAATAGAATCAAGG - Intergenic
984402665 4:179287058-179287080 ATAAATAAAGAGAAAAATAAAGG + Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986558023 5:9031219-9031241 ATGACTACAGTTAACAATCAGGG - Intergenic
986904612 5:12480063-12480085 ATGAAAACTGAAAAAAATCAAGG + Intergenic
986930550 5:12814849-12814871 ATGACTACAGAGAATAAGCAAGG - Intergenic
987395862 5:17422750-17422772 GTGAATAAAGAGAAGAATTGGGG - Intergenic
987965010 5:24861072-24861094 GTGAATACTGAGAACAATTAAGG + Intergenic
989408291 5:41086982-41087004 ATAAATACATATAAGAATCTTGG - Intergenic
989441452 5:41476651-41476673 AAGAATACAAAGAAAAATCAGGG - Intronic
989524994 5:42443002-42443024 ATGAAAACAGATTAGAAGCATGG + Intronic
990420556 5:55628315-55628337 ATGAAAAAACAGAAGAATCCTGG + Intronic
991430572 5:66540636-66540658 TTAAATACAGAGAAAAATCCAGG - Intergenic
991512261 5:67392723-67392745 AAGAAAAAAGAGAAGAACCAAGG - Intergenic
992589783 5:78282450-78282472 ATAATCACACAGAAGAATCAGGG + Intronic
992972014 5:82071160-82071182 ATGAATCCAGAGAGGAGGCATGG + Intronic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994260761 5:97655919-97655941 GTGGCTACAGAAAAGAATCAAGG - Intergenic
994285341 5:97957799-97957821 ATGCATACATATAAGAATTATGG - Intergenic
994380661 5:99067143-99067165 ATGAGTAAAGAGAAGAAAAATGG + Intergenic
994681581 5:102894431-102894453 AGGAGTTCAGAGAAAAATCAGGG - Intronic
994750852 5:103735278-103735300 AAGAACACAGAAAATAATCAGGG - Intergenic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
995928417 5:117405218-117405240 ATGAGTGGAGAAAAGAATCATGG - Intergenic
996295263 5:121907078-121907100 ATGAATTCAGTAAAGTATCAAGG + Intergenic
996797425 5:127364408-127364430 ATAAATGCAGAGTAGAATCCAGG - Intronic
997233692 5:132260455-132260477 ATGAAGTCAGAGAAGAGGCAGGG - Intronic
997890146 5:137668847-137668869 ATGAATCAACAGATGAATCAGGG + Intronic
998748909 5:145295312-145295334 AAGAAAAAAAAGAAGAATCATGG + Intergenic
999903927 5:156118464-156118486 ATGCACACAGAGAAGAGTCAGGG + Intronic
1000624332 5:163521987-163522009 ATGAATAAATAGAATAATGAGGG - Intergenic
1000769999 5:165341043-165341065 ATGACTACAGAGAAGTAAAAGGG + Intergenic
1000868470 5:166544789-166544811 ATGAATCCAAAGAAAAATAAAGG - Intergenic
1000956463 5:167549833-167549855 ATGAATGCATAGAAGTATAATGG - Intronic
1001988664 5:176097566-176097588 AAAAATGCAGAGAACAATCAGGG + Intronic
1002047684 5:176550976-176550998 AAGGACACAGAGAAGAATCAGGG - Intronic
1002228204 5:177740570-177740592 AAAAATGCAGAGAACAATCAGGG - Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003545500 6:7054812-7054834 ATGAATTCAGAGATGAAATATGG - Intergenic
1004348992 6:14874627-14874649 ATAATTTCAGAGAAAAATCAAGG - Intergenic
1004621380 6:17333447-17333469 ATAAATAAATAAAAGAATCAAGG - Intergenic
1005434390 6:25792740-25792762 ATGCAGAAAGAGAAGAAACAAGG - Intronic
1006028593 6:31162823-31162845 ATGACTACAGGGAAGAAGGATGG + Exonic
1007862553 6:44928592-44928614 GAGAATACAGAAAAGAAACAAGG + Intronic
1008129836 6:47708309-47708331 TTGAAGACAGGGAAGAATAAAGG + Intronic
1008325166 6:50170720-50170742 ATAAATATAGAGTAGAATGATGG + Intergenic
1008807329 6:55446735-55446757 ATGAATACATACAACAATAAAGG + Intronic
1009849538 6:69178252-69178274 CTGAACACAAAGAAGAAGCAGGG - Intronic
1010007944 6:71015984-71016006 ATGATTAGAGAGATGAAACAAGG + Intergenic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1010550609 6:77217910-77217932 ATAATTTCAGAGAAGAATGAAGG - Intergenic
1011434159 6:87319976-87319998 ATGAAAATAGAGTAGAATGATGG + Intronic
1011641957 6:89424153-89424175 ATGCAGAGAGAGAAGAATAAAGG - Intergenic
1012269597 6:97192305-97192327 ATAATTACAGAGAAAAATAAGGG + Intronic
1012437845 6:99234096-99234118 ATGACTACAGAGAAGAGAAATGG + Intergenic
1014182209 6:118397545-118397567 ATGAATTCAGAGATGAATTCAGG + Intergenic
1014196488 6:118566009-118566031 CTGTATGCAGAGAAGAGTCAAGG - Exonic
1014505956 6:122256488-122256510 CTGAATACAGAGAAGCAACTAGG + Intergenic
1014540571 6:122670778-122670800 ATCATCACAGAGATGAATCATGG - Intronic
1014648497 6:124005869-124005891 ATGAATAGATATAAGAAGCAGGG - Intronic
1015385487 6:132618226-132618248 AGAAAGGCAGAGAAGAATCAAGG + Intronic
1015591597 6:134827967-134827989 AAGAATAAAGAGATGAATCCCGG + Intergenic
1016955713 6:149624916-149624938 ATGAAGACAGAAAAGAAACTGGG + Intronic
1017489094 6:154928623-154928645 ATGAGTACAGAGGAAATTCATGG + Intronic
1017672739 6:156781723-156781745 AACATTATAGAGAAGAATCATGG + Intronic
1018577253 6:165272656-165272678 ATGGAGACAGAGGAGAATCCTGG + Intergenic
1020512245 7:9072329-9072351 ATGATTACAAAGAATAATCATGG + Intergenic
1020565128 7:9786137-9786159 ACAAATAGAGAGTAGAATCAAGG - Intergenic
1021087268 7:16436477-16436499 ATGAATAGAGGAAAGAATGAGGG + Intergenic
1021399119 7:20188946-20188968 ATGAATTCACACAAGAAACAAGG - Intronic
1021785856 7:24151966-24151988 AGGAATGCAGAGAAAAATCAAGG - Intergenic
1022059567 7:26778530-26778552 ATTAATATAGTGAAGAATAATGG - Intronic
1022321489 7:29292180-29292202 TTCAACACAGAGAAGAATTAAGG - Intronic
1022491613 7:30824853-30824875 ATAATAACAGAGAAGAAGCAAGG - Intronic
1022614411 7:31914429-31914451 ATTAACAAAGAGAAAAATCAAGG - Intronic
1023814835 7:43941653-43941675 ATGAATCAGGAGAAGAACCAAGG + Intronic
1023905326 7:44517631-44517653 AACCATACAGAGAAGAATCTCGG - Intronic
1024367677 7:48540119-48540141 ATGACTGCAGAGAAAAATCAAGG - Intronic
1024508805 7:50186306-50186328 ATGACTATAGCGAAGAATCCGGG + Intergenic
1024809104 7:53186522-53186544 TTGAATACAGAAAACAATAAAGG + Intergenic
1025274230 7:57560829-57560851 ATGAGTAAATAGAAGAATCAAGG + Intergenic
1025811223 7:64876894-64876916 ATGAAAGCAAAGAAAAATCAAGG - Intronic
1026235053 7:68520234-68520256 ATGAATTCAGAGGAAAAGCAAGG - Intergenic
1028301004 7:89200781-89200803 ATGAATGGAGGAAAGAATCAGGG - Intronic
1028560624 7:92171222-92171244 AAGAATACAGAAAACAATAATGG + Intronic
1028597457 7:92560586-92560608 TTGAATACACAGAAAATTCAAGG - Intergenic
1028944236 7:96558594-96558616 ACGAAGACAGAAAAGAAGCAAGG + Intronic
1030244041 7:107361208-107361230 ATGAATAAAATGTAGAATCAGGG + Intronic
1030841824 7:114363137-114363159 ATGAATACAGAATAGAAGAATGG - Intronic
1031187712 7:118503923-118503945 GAGAATAGAGAGAAGAATCAAGG + Intergenic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1032148715 7:129408730-129408752 AAGAATAGAGAAAAGAATAAAGG + Intronic
1032262550 7:130348586-130348608 ATGAACACAGACAAGAACCCTGG - Intronic
1032878693 7:136065704-136065726 ATAAATAAAGAGAAGAATGATGG + Intergenic
1034286467 7:149886596-149886618 ATGAACACACAGACGACTCAAGG + Intergenic
1034348132 7:150399343-150399365 CTGCATACAGAGAAGGATCTGGG - Intronic
1034600445 7:152248385-152248407 TGGTATCCAGAGAAGAATCAAGG - Exonic
1034607492 7:152330523-152330545 ATGACTATAGAGAAAATTCAAGG - Intronic
1035336702 7:158133921-158133943 CTGAAGACAGGGAAGACTCAGGG + Exonic
1037260050 8:16998843-16998865 ATAAATACAGAGATAACTCATGG + Intronic
1037366948 8:18132952-18132974 ATCAATAAAAAGAAGAATCTTGG + Intergenic
1037895566 8:22651456-22651478 ATGAAGAAAGAGGAGGATCAGGG - Intronic
1039841056 8:41293422-41293444 ATAAATACAGAGGAGAATGTTGG - Intronic
1040638139 8:49299768-49299790 AGGATTAGAGTGAAGAATCAAGG - Intergenic
1041551347 8:59104915-59104937 AGGAATACAGATAACTATCATGG - Intronic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1043307336 8:78812076-78812098 AGAAATAAAGAGAAGAACCATGG - Intergenic
1043606595 8:82008122-82008144 ATAAATATAGAGAAGAATCTGGG + Intergenic
1043773214 8:84231467-84231489 GTGAACACAGAGAACAAACATGG - Intronic
1043931888 8:86100885-86100907 AAGAATTCAGAGATAAATCAAGG + Intronic
1044564029 8:93643830-93643852 ATAAATACAGCTAAGAACCATGG - Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1045850350 8:106688739-106688761 AGGCATAGAGAGAAGAATGATGG + Intronic
1045869814 8:106912539-106912561 ATGAATACAAAGGATAATAAAGG - Intergenic
1046130816 8:109966181-109966203 ATGAATACAGAGCATAGTCCTGG + Exonic
1046239563 8:111473181-111473203 AAGAATTCAGTGAAGAAGCACGG + Intergenic
1047022635 8:120792307-120792329 ATGCATACAGAGAGGGATAATGG + Intronic
1048245413 8:132791722-132791744 ATTAAAATAGAGAAGAATCTTGG + Intronic
1049736756 8:144211763-144211785 ATAAAAACACAAAAGAATCAAGG - Intronic
1049753272 8:144295935-144295957 GTGAAGACAGAGAAGCATCCAGG - Intronic
1050136567 9:2472047-2472069 ATGAAGAAAGAGAATAATCAGGG - Intergenic
1050289110 9:4135375-4135397 ATGAATTCAGAGAAGAATGTGGG - Intronic
1050299952 9:4248069-4248091 TTGAATTCATAGAAGAATAATGG - Intronic
1050379597 9:5013062-5013084 GTGAAAAAAGAGAAGAATAAAGG + Intronic
1050632409 9:7574261-7574283 ATGAACACTCAGAAGCATCATGG + Intergenic
1051372525 9:16370672-16370694 ATGAATGCACAGTTGAATCATGG - Intergenic
1052043692 9:23770218-23770240 ATACATATAGAGAAGAATAAGGG + Intronic
1052311026 9:27069148-27069170 ATGAAAATAGAGTAGAATGATGG - Intergenic
1052859161 9:33426333-33426355 GTGCATGCAGAGAAGATTCAGGG + Intergenic
1053373755 9:37586496-37586518 ATGGAGACAGAGTAGAATGATGG + Intronic
1053720842 9:40945497-40945519 GTGAATGCAAACAAGAATCAAGG + Intergenic
1055349672 9:75373389-75373411 ATGAAGACAGACAAGAATCTGGG - Intergenic
1056409761 9:86313343-86313365 GGGAATACACAGAAGAAGCAAGG + Intronic
1056647215 9:88424112-88424134 ATGTATACAGAGAAAAAGTATGG + Intronic
1056899680 9:90586118-90586140 ATGAATTGTGAGAAGAATCGAGG - Intergenic
1058205380 9:102099761-102099783 CTGAATACAAAGATTAATCAGGG + Intergenic
1058549054 9:106093705-106093727 ATGTAGACAGGGAAGAAACAAGG + Intergenic
1058993449 9:110276399-110276421 ATGAACACAGAGAGAAAACAAGG + Intergenic
1059030613 9:110691457-110691479 AGGAGAACAGAGACGAATCAAGG - Intronic
1059044543 9:110851526-110851548 ATTAATACAGGGAACAATTAGGG + Intergenic
1059355313 9:113694702-113694724 ATGAGGAGGGAGAAGAATCATGG + Intergenic
1059382940 9:113942517-113942539 ATGGATACAGAGAAGACTGGAGG - Intronic
1059549349 9:115213151-115213173 ATAAACACAGAGTAGAATGAAGG + Intronic
1059766103 9:117385545-117385567 ATGAGTACAGACAAGAGTGAGGG + Intronic
1060123625 9:121020361-121020383 AAGACTACAGACAAGAATGATGG + Intronic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1061963389 9:133999214-133999236 ATGAATACAGGGATGAATGGAGG - Intergenic
1186183394 X:6994624-6994646 AAGAATGCAGAAAAGAATGAGGG + Intergenic
1186262581 X:7795470-7795492 ATGTATACAGGTAAGAATCTAGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1187469427 X:19555526-19555548 ATGAATGCAGAGAACAATTTAGG - Intronic
1187597401 X:20788243-20788265 ATTTAGACAGAGAAGAATCAAGG - Intergenic
1188128847 X:26405345-26405367 ATTAGTTCAGAGAAGCATCACGG - Intergenic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189402602 X:40685774-40685796 ATGATTGCAGAGATGCATCAAGG + Intronic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1190171766 X:48116549-48116571 ATGAATACAGGGAAGAGAGAGGG - Intergenic
1191131603 X:57018704-57018726 ATGAATAGAGAGAAGAAAACGGG + Intergenic
1192460476 X:71312856-71312878 ATAAATACAAAGAAGATACATGG + Intergenic
1192635718 X:72814797-72814819 AAGAAAAGAGAGAAGAATCAGGG - Intronic
1192645996 X:72906006-72906028 AAGAAAAGAGAGAAGAATCAGGG + Intronic
1193132660 X:77933879-77933901 ATTAATACAGTGAAAAAACAAGG + Intronic
1193279904 X:79634965-79634987 ATGGAGACAGAGTAGAATGATGG - Intergenic
1193543348 X:82797621-82797643 ATGAATACAGTGAAAGTTCAGGG + Intergenic
1193744860 X:85265076-85265098 ATTAAAATAGAGAAGTATCATGG - Intronic
1193845511 X:86465811-86465833 ATGATTACATTGAAGAGTCATGG - Intronic
1194129343 X:90061106-90061128 ATGGATATAGAAAAGAACCATGG + Intergenic
1194793328 X:98178503-98178525 GAGAATACAAAGTAGAATCATGG - Intergenic
1195150970 X:102069691-102069713 ATGCATGCAGAGAAAAATAATGG - Intergenic
1195385201 X:104307563-104307585 AAGAATTCAGAGAAGAAGCGGGG + Intergenic
1197785699 X:130194737-130194759 ATGAATTCAGCTAAGAATGAAGG - Intergenic
1199046010 X:143174177-143174199 CAGAACACAGAAAAGAATCAAGG + Intergenic
1199084736 X:143615673-143615695 AGGAACACAGAGAGGAATCTTGG - Intergenic
1199807355 X:151313459-151313481 ATGAAAACAAAGAAAAATAATGG + Intergenic
1200335854 X:155350647-155350669 TAGACTACAGAGAAGAATCTAGG - Intergenic
1200350615 X:155490579-155490601 TAGACTACAGAGAAGAATCTAGG + Exonic
1200699910 Y:6393246-6393268 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200910708 Y:8529162-8529184 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200913096 Y:8548268-8548290 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200913416 Y:8550754-8550776 ATGAAAACAAAGAAAAATGAAGG - Intergenic
1200917022 Y:8580274-8580296 ATGAAAGCAAAGAAAAATCATGG - Intergenic
1200926290 Y:8657887-8657909 ATGAAAACAAAGAAAAGTCAAGG - Intergenic
1200933714 Y:8720158-8720180 AGGAAAACAAAGAAAAATCAAGG + Intergenic
1200934625 Y:8727455-8727477 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200935326 Y:8733333-8733355 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200938805 Y:8761498-8761520 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200961863 Y:9003282-9003304 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200982028 Y:9271224-9271246 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1201034201 Y:9771452-9771474 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1202149216 Y:21829587-21829609 ATGAAAGCAAAGAAAAATCAAGG - Intergenic