ID: 1133920454

View in Genome Browser
Species Human (GRCh38)
Location 16:10148059-10148081
Sequence GCTGACAGGGAGCAACCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133920454 Original CRISPR GCTGACAGGGAGCAACCAGT AGG (reversed) Intronic
900406814 1:2496402-2496424 GCTGGCTGGGAGCTACCAGCAGG - Intronic
901134765 1:6986068-6986090 GACGGCAGGGAGCAGCCAGTGGG - Intronic
902810792 1:18886665-18886687 CTTAACAGGGAGCAACCTGTGGG - Intronic
904270970 1:29349811-29349833 GGAGACAGGGAGCAGCCAGCAGG - Intergenic
908511321 1:64852123-64852145 GCTGGCATGGAGAAAACAGTCGG - Intronic
911180135 1:94853154-94853176 ACTGAAAGGGAGTGACCAGTGGG + Intronic
913645037 1:120847636-120847658 GCAGGCAGGGAGGGACCAGTGGG - Intergenic
914099412 1:144570932-144570954 GCAGGCAGGGAGGGACCAGTGGG - Intergenic
914299573 1:146366745-146366767 GCAGGCAGGGAGGGACCAGTGGG + Intergenic
914804365 1:150981873-150981895 GCTGATAGGGAAAAACCTGTTGG - Intergenic
917256989 1:173126107-173126129 GCTGGCAGGGAGCGGGCAGTGGG + Intergenic
919803042 1:201364964-201364986 GCAGTCAAGGAGCATCCAGTAGG + Intronic
919975044 1:202604874-202604896 GCTGAGAGGTAGCAACCAGGTGG + Intronic
921031889 1:211341251-211341273 GCTGACAAGGAGCCACCAAGAGG + Intronic
922218757 1:223541780-223541802 GGTGACAAGAAGCAAGCAGTGGG + Exonic
922292621 1:224221120-224221142 GCTGGCAGGGAGCATGCATTAGG - Intergenic
922799115 1:228356283-228356305 GCAGACAGGCAGCAAGCAGGTGG - Intronic
922800272 1:228361903-228361925 GCTGAGGGGGAGCTGCCAGTGGG + Intronic
923210472 1:231799707-231799729 GCTAACAGAGAGCAACCACAAGG - Intronic
924300610 1:242633820-242633842 CCTGACAGAGAGCTAGCAGTAGG - Intergenic
924518402 1:244785136-244785158 GGAGACAGCGAGCAACCATTTGG - Intergenic
1066043667 10:31578367-31578389 GCTGGCAGGGAGCCAACAGGAGG - Intergenic
1066247027 10:33593511-33593533 ACTGTCAGGGAGCACCCAGAGGG - Intergenic
1066337175 10:34489565-34489587 GCTGCCTTGGAGCAACCAGTTGG - Intronic
1070420072 10:76227960-76227982 GCTCACAGAGTTCAACCAGTGGG + Intronic
1070596897 10:77838757-77838779 CCTGACAGGCAGCAGCCAGTGGG + Intronic
1071761161 10:88608954-88608976 GCTTACACCAAGCAACCAGTGGG + Intergenic
1077106024 11:843028-843050 GCCGACACGCAGCAACAAGTGGG + Intronic
1079221848 11:18569971-18569993 AAAGACAGGGAGCAAACAGTTGG + Intronic
1080893524 11:36429748-36429770 GGTGAAAGGGACCAACCAGGTGG + Intronic
1083171422 11:60925666-60925688 GCTGAGAGGGAGCTAGCTGTGGG + Intronic
1083278445 11:61610902-61610924 GCAGACAGCCCGCAACCAGTAGG + Intergenic
1083719618 11:64597936-64597958 GCTGACAGGGTGCGGCCAGAGGG + Intronic
1084202663 11:67571660-67571682 GCTTACAGGGTGTAACCAATTGG + Intergenic
1084597253 11:70124328-70124350 GCTGAGGGGGAGGAAGCAGTGGG - Exonic
1084972505 11:72779621-72779643 GCTCTCAGGGAACAACCAGCTGG + Intronic
1087162651 11:94964701-94964723 GCTAACAAGGAGCAGCCAGTTGG - Intronic
1090231728 11:125111789-125111811 GCTGACAGGCACCGACCAATCGG - Intergenic
1091229141 11:133976575-133976597 GCTGACTGAGGCCAACCAGTTGG - Intergenic
1091384175 12:81830-81852 GCTGAGAAGGAGCACCCAGAGGG + Intronic
1092405530 12:8219548-8219570 GCGGAAAGGGAGCAGCCATTTGG + Intergenic
1093387867 12:18581913-18581935 GCTGAGCAGGAGCAACCAGTTGG + Intronic
1093542122 12:20299457-20299479 GCTGACTAGGAGCACCCAGGAGG - Intergenic
1094348344 12:29496864-29496886 GCTGAAAGGGAGCAGACAGGAGG - Intronic
1095261510 12:40104964-40104986 GCTGAGAGGCAACAACCACTTGG + Intronic
1099193300 12:79583360-79583382 GTTGGCACGGAGCAGCCAGTAGG - Intronic
1102857270 12:116305186-116305208 GCTGACAAGTAGCAAATAGTTGG - Intergenic
1105408308 13:20149894-20149916 GCTGAGAGGGAGCAACAGGCTGG + Intronic
1105711491 13:23013606-23013628 GCAGACATGGAAGAACCAGTAGG - Intergenic
1106027336 13:25967753-25967775 GCTAAAAGTGAGCTACCAGTTGG - Intronic
1106825667 13:33517926-33517948 TGTGGCAGGGAGCAGCCAGTAGG - Intergenic
1108431635 13:50359584-50359606 GCTTGCAGGGAGCAAGAAGTCGG - Intronic
1108948773 13:56060332-56060354 GCTGACAGCGAGCAAGAAATTGG - Intergenic
1112052863 13:95661535-95661557 CCTGAAAGGCAGCAAGCAGTGGG - Intergenic
1114628805 14:24146705-24146727 GCTGGCAGGCCGCAAGCAGTAGG + Exonic
1114948016 14:27711468-27711490 GCTGGGAGGGAGGAAGCAGTGGG - Intergenic
1118195471 14:63621786-63621808 ACTGACTGTGAGCAATCAGTTGG - Intronic
1118819320 14:69334756-69334778 GCAGACAGGGAGGCACCAGCAGG - Intronic
1120702651 14:87714878-87714900 ACTGAGAAGGAGCAACCAGTGGG + Intergenic
1121495121 14:94386773-94386795 GCTGGCAGGCAGTAAACAGTTGG - Intronic
1121979516 14:98442516-98442538 GGTGACAGGGAGCAGAGAGTGGG + Intergenic
1122826905 14:104374970-104374992 ACTGCCTGGGAGCACCCAGTGGG + Intergenic
1124383954 15:29190612-29190634 CCTGACAGGAAGCAAGTAGTTGG + Intronic
1128062821 15:64746062-64746084 ACTGTCAGGGGGCAAGCAGTGGG + Intronic
1128556255 15:68633913-68633935 GGTGACAGGGAGCAACGTCTTGG + Intronic
1130100175 15:80887455-80887477 GCTCACAGGGAGCAAACATCAGG + Intronic
1133868027 16:9661794-9661816 GCTGTCAAGGAGCAAGCAGAGGG - Intergenic
1133920454 16:10148059-10148081 GCTGACAGGGAGCAACCAGTAGG - Intronic
1134278756 16:12800023-12800045 GCTGCCAGGGGGCCACCACTGGG - Intronic
1134683421 16:16142222-16142244 ACTGAGAGTGAGCAACCAGCTGG + Exonic
1139941761 16:70610697-70610719 GCTGACAAGAAGAAACCAGCTGG + Intronic
1141798777 16:86292919-86292941 GCTGACAGTGAGACACCAGGAGG + Intergenic
1141983722 16:87565979-87566001 GCTGACAGGTAGCAAGAAGATGG - Intergenic
1143108008 17:4539036-4539058 GCTGTGAGGGAGCCACCAGGGGG - Intronic
1145348113 17:22054776-22054798 GCTGAGTGGGAGAAACCAGAGGG - Intergenic
1145415468 17:22710610-22710632 GCTGAGTGGGAGAAACCAGAAGG + Intergenic
1147794804 17:43034727-43034749 GCAGACAGGGAACCACCAGGAGG + Intergenic
1151433724 17:74081534-74081556 GCTGGGAGGGAGCAGCCAGAGGG - Intergenic
1151978993 17:77498137-77498159 GCTGGCAGGGTGGAAGCAGTGGG - Intronic
1153000505 18:451172-451194 ACTGACAGGGAGCAGGCAGGAGG - Intronic
1155294350 18:24371637-24371659 GCTGCCAGGGAGCACAGAGTAGG - Intronic
1159924306 18:74253635-74253657 GATGGCAGGGATCACCCAGTTGG + Exonic
1160109799 18:76015629-76015651 GGTGAGAGGGGGGAACCAGTTGG - Intergenic
1163375599 19:16928263-16928285 GCTGGCAGGAAGCAGGCAGTAGG + Intronic
1164432661 19:28201499-28201521 GCCCACAGGAAGCAACAAGTGGG - Intergenic
1166369339 19:42292576-42292598 CCTGACCGGGAGCCAGCAGTGGG - Exonic
925224559 2:2172170-2172192 GCTGCCAGGCAGCAGCCACTAGG + Intronic
925860567 2:8171799-8171821 GCTGGCAGGAAGTCACCAGTTGG - Intergenic
925917978 2:8620604-8620626 GCTGACAGGGAGATACAAATAGG + Intergenic
926075336 2:9938191-9938213 ACTGACACGGAGCACCCTGTAGG + Intergenic
926119629 2:10235041-10235063 GCTGATGGGGAGCAGCCAGAAGG - Intergenic
928442371 2:31303078-31303100 ACTGACAGGAACCAGCCAGTCGG - Intergenic
929565814 2:42984024-42984046 GATGACAGGCAGCAGGCAGTGGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
937414058 2:121700197-121700219 CCTGGCAGTGAGGAACCAGTGGG + Intergenic
938450572 2:131415556-131415578 ACTGACTGGGAGCAACCCATAGG - Intergenic
938911858 2:135892905-135892927 GCAGAGAGGGAGCAGCTAGTGGG + Intergenic
947774395 2:232696523-232696545 GCTGACAGGAAGGATCCTGTAGG + Intergenic
947795394 2:232891000-232891022 GCTGACAGGGAGGAGCTGGTGGG - Intronic
948786434 2:240355227-240355249 GCTGAGAGGGAGCCAGCAGCTGG + Intergenic
1168787485 20:552427-552449 CCTGAGAAGGAGCAGCCAGTGGG + Intergenic
1171157127 20:22885826-22885848 GATGGCAGGGATCACCCAGTTGG + Intergenic
1171518786 20:25759967-25759989 GCTGAGTGGGAGAAACCAGAGGG + Intergenic
1171558070 20:26096243-26096265 GCTGAGTGGGAGAAACCAGAGGG - Intergenic
1172989862 20:39026829-39026851 GCTTACAAGGAGCACCTAGTTGG + Intronic
1176652930 21:9566375-9566397 GCTGAGTGGGAGAAACCAGAAGG + Intergenic
1179610823 21:42548768-42548790 GGTGACAGAGACCAACCAGATGG - Intronic
1181498276 22:23300668-23300690 GCTGCCAGGGTGCCACCAGGAGG + Intronic
1184201926 22:42975710-42975732 CCTGGCAGGGAGCACCCACTAGG + Intronic
1184445952 22:44547008-44547030 GCGGACAGAGAGCAACAAGGGGG - Intergenic
1184688633 22:46107572-46107594 GCTGACGGGGAGTGAGCAGTCGG - Intronic
950569583 3:13791853-13791875 GCTGACAGGGAATAGCCAGCCGG - Intergenic
953240930 3:41148882-41148904 GCTCAGAGGGAGAAAGCAGTTGG + Intergenic
953550488 3:43898701-43898723 ACTGACAGGGAGCAGCCCTTGGG + Intergenic
953585037 3:44191992-44192014 GTTGTCAGGGAGGAAACAGTGGG + Intergenic
960470283 3:118055840-118055862 GTTGACTAGGAGCAACCTGTAGG + Intergenic
967091777 3:186140728-186140750 GCTGACAGGGAGCAGACGGGAGG + Intronic
969760583 4:9178423-9178445 GCGGAAAGGGAGCAGCCATTTGG - Intergenic
971789759 4:31154305-31154327 GGAGACAGAGAGCAACCACTTGG - Intergenic
979179534 4:117707877-117707899 GCTGGCATGGAGAAACCAGGAGG + Intergenic
979577495 4:122311847-122311869 GATGACTTGGAGCAACCATTAGG - Intronic
981357086 4:143801810-143801832 GTTGACAGGCAACAGCCAGTAGG - Intergenic
981368621 4:143932404-143932426 GTTGACAGGCACCAGCCAGTAGG - Intergenic
984865828 4:184279785-184279807 GGTGACAGGGAGACACTAGTGGG + Intergenic
985774527 5:1833901-1833923 GGTGGCAGGGATCCACCAGTGGG + Intergenic
991072076 5:62494944-62494966 GCTGACAGGCAAAAACCAGGTGG - Intronic
997690794 5:135826191-135826213 GCTGGCAGGGAGCAGCCTGGTGG - Intergenic
1007237181 6:40399122-40399144 ACTGACAGGGTGAAACCACTTGG - Intronic
1007827255 6:44609978-44610000 ACTGACTGGGGGCAACCAGCAGG - Intergenic
1008358571 6:50586677-50586699 GCAGCCAGGTAGCAACCACTGGG + Intergenic
1009734974 6:67663869-67663891 GCTGACTGGAAGCAGCCAGAAGG - Intergenic
1011571822 6:88746237-88746259 GACCACAGGGAGCAGCCAGTTGG - Intronic
1012244249 6:96908820-96908842 GCTGGCTGGGAGCAAGCAGGAGG - Intergenic
1012451323 6:99355173-99355195 ACTGAGAAGGAGCAACAAGTGGG + Intergenic
1015782930 6:136889997-136890019 GCTGACTGGCAGTACCCAGTTGG - Intronic
1018427678 6:163698287-163698309 GCTGACAGGAAGCAAAGAGAAGG + Intergenic
1019929814 7:4215951-4215973 TCACACAGGGAGCAAGCAGTGGG + Intronic
1020468813 7:8512109-8512131 GATGACAGGAAGGAACCAGAGGG + Intronic
1022571385 7:31457450-31457472 ACTTACAGGGAGCAAACAGGGGG + Intergenic
1022877649 7:34551975-34551997 GCTGACTGGATGCAACCAGGAGG + Intergenic
1023219380 7:37903324-37903346 ACTGACTGGGAGCAACCCATAGG - Intronic
1024228882 7:47349019-47349041 GCTGACACAGAGCCAACAGTGGG + Intronic
1025279276 7:57615096-57615118 GCTGAGTGGGAGAAACCAGAGGG + Intergenic
1025305455 7:57850404-57850426 GCTGAGTGGGAGAAACCAGAGGG - Intergenic
1026208019 7:68275880-68275902 GATGTCAGGGAGCAAATAGTGGG - Intergenic
1027509537 7:79062446-79062468 GATGACAGGGAGGAGCCAGACGG - Intronic
1031440185 7:121785143-121785165 GTTGACAGGAAGAAACCAGTAGG + Intergenic
1034852141 7:154503383-154503405 GCTGAGAGGCAGCAATCAATTGG - Intronic
1035300066 7:157891368-157891390 TGTCACAGGGAGCAAGCAGTGGG - Intronic
1036020592 8:4841016-4841038 GCTGACAGGGTGGAGCCAGGGGG - Intronic
1036262922 8:7254536-7254558 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036264226 8:7262159-7262181 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036265521 8:7269781-7269803 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036266823 8:7277403-7277425 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036268129 8:7285025-7285047 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036269433 8:7292647-7292669 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036297159 8:7546777-7546799 GCGGAAAGGGAGCAGCCAGTTGG + Intergenic
1036298462 8:7554432-7554454 GCGGAGAGGGAGCAGCCAGTTGG + Intergenic
1036299767 8:7562082-7562104 GCGGAGAGGGAGCAGCCAGTTGG + Intergenic
1036301072 8:7569728-7569750 GCGGAAAGGGAGCAGCCAGTTGG + Intergenic
1036302376 8:7577377-7577399 GCGGAGAGGGAGCAGCCAGTTGG + Intergenic
1036303666 8:7585022-7585044 GCGGAAAGGGAGCAGCCAGTTGG + Intergenic
1036314961 8:7713076-7713098 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036316267 8:7720698-7720720 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036317577 8:7728346-7728368 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036318886 8:7735994-7736016 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036320193 8:7743641-7743663 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036321502 8:7751289-7751311 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036322811 8:7758937-7758959 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036324112 8:7766586-7766608 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036325409 8:7774242-7774264 GCGGAGAGGGAGCAGCCAGTTGG - Intergenic
1036351928 8:8017721-8017743 GCGGAAAGGGAGCAGCCAGTTGG + Intergenic
1036353228 8:8025367-8025389 GCGGAGAGGGAGCAGCCAGTTGG + Intergenic
1036354521 8:8033014-8033036 GCGGAGAGGGAGCAGCCAGTTGG + Intergenic
1036845927 8:12170496-12170518 GCGGAAAGGGAGCAGCCATTTGG + Intergenic
1036867292 8:12412815-12412837 GCGGAAAGGGAGCAGCCATTTGG + Intergenic
1037929700 8:22871227-22871249 GCTGTCAGAGAGAAACCAGTAGG - Intronic
1042700355 8:71605841-71605863 GCTAAGAGGGAACAAGCAGTTGG - Intergenic
1043170396 8:76958777-76958799 GCTCAGAGGGAGCACACAGTTGG + Intergenic
1043486269 8:80702014-80702036 GCTGACAGGAAGGAGCTAGTAGG + Intronic
1043492738 8:80765270-80765292 GCTGGCAGGCACCATCCAGTTGG - Intronic
1046097160 8:109575603-109575625 GCTGACAGGGAGCTACTGGTAGG - Exonic
1046593008 8:116228261-116228283 GCTGTCAGGGAGCAGGGAGTAGG + Intergenic
1047562095 8:125997926-125997948 GCTTCCAAGGAGCAGCCAGTAGG + Intergenic
1048482113 8:134807626-134807648 GGTGACAGGGAGAAAACACTTGG + Intergenic
1051048102 9:12899771-12899793 GGTGACAGGGAGCAACTAAGAGG - Intergenic
1055649721 9:78395509-78395531 GCAGACAGGGAGAAACCATCTGG + Intergenic
1058811103 9:108640360-108640382 GCGGAGAGGTAGCAACTAGTTGG - Intergenic
1062409669 9:136416954-136416976 GCTTACAGGGAGAACACAGTTGG + Exonic
1203630659 Un_KI270750v1:69916-69938 GCTGAGTGGGAGAAACCAGAAGG + Intergenic
1185514528 X:689139-689161 GGTGAGAGTGAGCAACCTGTGGG - Intergenic
1185754927 X:2645607-2645629 GCTGTCTGGGAGCAAGCAGAGGG + Intergenic
1187805210 X:23112073-23112095 GATAAAAGGGAGCCACCAGTAGG - Intergenic
1189003406 X:36969411-36969433 TTTGACAGGCACCAACCAGTGGG - Intergenic
1189046231 X:37594472-37594494 TTTGACAGGCATCAACCAGTGGG + Intronic
1189373930 X:40451617-40451639 GGTGACAGGAATCAAACAGTTGG - Intergenic
1189660026 X:43286679-43286701 GCTGACTAGAAGCAGCCAGTGGG - Intergenic
1190981062 X:55456976-55456998 GCTGACAGACAGCAAACAGTGGG + Intergenic
1190987635 X:55516204-55516226 GCTGACAGACAGCAAACAGTGGG - Intergenic
1191024986 X:55904716-55904738 ACTGAAAAGGAGCAGCCAGTAGG + Intergenic
1193868763 X:86770419-86770441 TCTGACATGGAGAAACCAGAGGG - Intronic
1198251067 X:134879728-134879750 GCTCACCTGTAGCAACCAGTCGG + Intergenic
1198557584 X:137811647-137811669 GCTAATAGGGAGCAAGCAGAAGG - Intergenic