ID: 1133924215

View in Genome Browser
Species Human (GRCh38)
Location 16:10180985-10181007
Sequence AAGTGTGTGGTGCACACGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133924215_1133924219 9 Left 1133924215 16:10180985-10181007 CCCGTCGTGTGCACCACACACTT 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1133924219 16:10181017-10181039 CCCAGCCCCAACTACAGACCCGG 0: 1
1: 0
2: 7
3: 40
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133924215 Original CRISPR AAGTGTGTGGTGCACACGAC GGG (reversed) Intronic
900185202 1:1330028-1330050 ACGTGTACGGTGCACACGAATGG - Intergenic
900804544 1:4758755-4758777 GAGAGTGTGGTGCATACGTCAGG + Intronic
906145870 1:43560307-43560329 ATGTGTGTGGTGCATACAGCAGG + Intronic
913105629 1:115611737-115611759 AGGTGTTTGGTGCACAAGAGAGG - Intergenic
920949024 1:210555429-210555451 AATTGTGAGGTGAACAAGACTGG + Intronic
921827927 1:219694873-219694895 AAGTATATGGTGAACAAGACAGG + Intronic
1066435595 10:35394539-35394561 AAGTGTATGGGTCACACGGCCGG + Intronic
1067187175 10:44040501-44040523 AAGTGTGTGGGGCATAAAACTGG + Intergenic
1069838694 10:71325839-71325861 GAGTTTGTGGTGCACTGGACAGG + Intronic
1074438547 10:113454961-113454983 AAGTGGGTGGGGCACAGGGCAGG + Intergenic
1076548423 10:131261385-131261407 ATGTGGGTGGGTCACACGACAGG - Intronic
1079416545 11:20243163-20243185 AAGTTTGTGGGGAACACTACTGG - Intergenic
1081479434 11:43471349-43471371 AAGTGGGTGGAGCAGACGGCTGG - Intronic
1087390732 11:97529544-97529566 TATTGTCTGGTGCACTCGACAGG - Intergenic
1117252093 14:53948253-53948275 ATGTGTGTGGTGCACACTCCTGG - Intergenic
1117532541 14:56673731-56673753 AAGTGTCTGGTACACACGAGTGG + Intronic
1124234895 15:27981660-27981682 AAGTGCTTGACGCACACGACAGG - Intronic
1127383463 15:58449037-58449059 AAGCGCTAGGTGCACACGACGGG + Intronic
1129250034 15:74303655-74303677 GAGTGTGTGCTGCACAGAACAGG - Intronic
1132002806 15:98196967-98196989 AAGTGAGTGGGGCACAAGAGTGG - Intergenic
1133924215 16:10180985-10181007 AAGTGTGTGGTGCACACGACGGG - Intronic
1138383554 16:56620313-56620335 AAGTGTGTGATTCACACAATGGG - Intergenic
1138946820 16:61861232-61861254 AAAAGTTTGGTGCACACTACAGG - Intronic
1141509300 16:84502266-84502288 AAGTGTGTGGTTGCCACAACTGG + Intronic
1142698011 17:1644106-1644128 AAGTGAGTGTTGCCCAGGACAGG - Intronic
1152076594 17:78163902-78163924 AATTGTGTGGTACACACGGCAGG + Intronic
1152148072 17:78581144-78581166 GAGGCTGTGTTGCACACGACAGG - Intergenic
1155605861 18:27605413-27605435 AAGTGTGTGCTGCCCTCTACTGG - Intergenic
1159470414 18:68847451-68847473 AAGTCTGTGCTGCACACTAGTGG - Intronic
1160374772 18:78403298-78403320 AGGTGTGTGGTGCACAAGCTTGG - Intergenic
1162483278 19:10942185-10942207 TAGTGTGTGGTGAACACTAGAGG + Intergenic
1167770359 19:51510985-51511007 ATGTGTGTGTTGCCCACAACTGG - Intergenic
925156843 2:1655481-1655503 CAGTGTGTGGTGCATACCTCTGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928683300 2:33725201-33725223 GAGTGTGTGGTGCACATGCCCGG - Intergenic
931234507 2:60401894-60401916 AAGTGTGGGGAGCAGAAGACTGG - Intergenic
936251733 2:110873160-110873182 AACTGTGTTGTGCACACCATGGG + Intronic
1175109875 20:56640248-56640270 ATGTTTGTGATGCACACGGCAGG + Intergenic
1181631805 22:24155624-24155646 AGGTGTGTGGGGGAAACGACTGG - Intronic
951527791 3:23670459-23670481 AACTGTGTGGTGCACCTGAGGGG - Intergenic
969418544 4:7076480-7076502 GAGTGTGTGCTGCACACTCCAGG - Intergenic
976107127 4:81630919-81630941 CTGTGTGTGGTGAACACGACAGG - Intronic
977289285 4:95146008-95146030 CAGTGTGTCTTGCACATGACAGG - Intronic
981653392 4:147084541-147084563 AAGTGTGAGGTGGAGACAACAGG - Intergenic
989059865 5:37399855-37399877 ATGTGTGTGGTGCAGATAACTGG + Intronic
992436617 5:76760882-76760904 AGGTGTGTGGTACACATGAGAGG + Intergenic
997634630 5:135396247-135396269 AAGTGTGGGCTTCACAGGACAGG + Intronic
998545207 5:143021938-143021960 AAGTGGGGTGTGCACACCACTGG + Intronic
998625525 5:143841588-143841610 AAGTTTGAGGTTCACAAGACTGG - Intergenic
1003975910 6:11344429-11344451 AAGAGTGTGATGCTTACGACAGG - Intronic
1006480444 6:34288790-34288812 GAGTATGTGGTGGCCACGACTGG + Exonic
1008437735 6:51495981-51496003 TAGCGTGTGGTGCACTGGACAGG + Intergenic
1012723091 6:102772913-102772935 CAGTGTGTGGTTCACATGATGGG + Intergenic
1018468746 6:164078308-164078330 AAGTGGGTGGGGCACAAGCCTGG - Intergenic
1024527463 7:50360909-50360931 AAGAGTGTGGGTCACACGGCGGG - Intronic
1025926888 7:65967554-65967576 AAGTGAGTGGGGCACAGGCCTGG + Intronic
1028578431 7:92379898-92379920 AAGTGGGTGCAGCACACGAAGGG + Intronic
1032903839 7:136341464-136341486 AAGTGTATGATGCACAGGGCTGG - Intergenic
1033228555 7:139579666-139579688 AAGTTTCTGGTGCTCACTACAGG + Intronic
1035292826 7:157850479-157850501 TAGTCTGTGGTGCACACACCAGG - Intronic
1036960959 8:13244069-13244091 AAGTGTGTGAAGCACAGGAAAGG - Intronic
1040568673 8:48589301-48589323 AGGTGTGTGGTGAGAACGACGGG - Intergenic
1049436352 8:142587868-142587890 GTGTGTGGGGTGCACCCGACAGG + Intergenic
1049662844 8:143828108-143828130 CAGTGTGTGATTCACAGGACTGG - Intronic
1050452108 9:5793231-5793253 AAATGTGTACTGCAAACGACAGG + Intronic
1055319503 9:75068480-75068502 AAGTGGGTGTGGCACACGAAAGG - Intronic
1057501622 9:95601124-95601146 AAGTGGGTGGTGCACAGGAAGGG - Intergenic
1057883306 9:98808973-98808995 AGGTGCCTGGTGCACACGGCAGG - Intronic
1187467999 X:19543253-19543275 ACGGGTGTGGTGCACACACCAGG + Intronic
1201266775 Y:12214431-12214453 AAGTGTGTGCTGCACAGGATAGG - Intergenic
1201266802 Y:12214748-12214770 AAGTGTGTAGTGCACAGGGGAGG - Intergenic
1201266874 Y:12215440-12215462 AAGTGTGTCTTACACAGGACAGG - Intergenic
1201267126 Y:12218084-12218106 AAGTTTGTCCTGCACAGGACAGG - Intergenic
1201716319 Y:17047675-17047697 AAGTGTGTCATGCACAGGAGAGG + Intergenic