ID: 1133929698

View in Genome Browser
Species Human (GRCh38)
Location 16:10222304-10222326
Sequence CTAGAATTGCAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133929695_1133929698 -7 Left 1133929695 16:10222288-10222310 CCTCACACCACTGTTGCTAGAAT No data
Right 1133929698 16:10222304-10222326 CTAGAATTGCAGATGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133929698 Original CRISPR CTAGAATTGCAGATGGAAGA AGG Intergenic
No off target data available for this crispr