ID: 1133931691

View in Genome Browser
Species Human (GRCh38)
Location 16:10238061-10238083
Sequence GGTTAAAGTAGACGAATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133931691_1133931699 26 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data
1133931691_1133931695 4 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931695 16:10238088-10238110 CCTGCCAACGCAATCCATCCTGG No data
1133931691_1133931700 27 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133931691 Original CRISPR GGTTAAAGTAGACGAATAGC AGG (reversed) Intergenic
No off target data available for this crispr