ID: 1133931693

View in Genome Browser
Species Human (GRCh38)
Location 16:10238082-10238104
Sequence TGGATTGCGTTGGCAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133931693_1133931700 6 Left 1133931693 16:10238082-10238104 CCAGGTCCTGCCAACGCAATCCA No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data
1133931693_1133931699 5 Left 1133931693 16:10238082-10238104 CCAGGTCCTGCCAACGCAATCCA No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133931693 Original CRISPR TGGATTGCGTTGGCAGGACC TGG (reversed) Intergenic
No off target data available for this crispr