ID: 1133931695

View in Genome Browser
Species Human (GRCh38)
Location 16:10238088-10238110
Sequence CCTGCCAACGCAATCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133931691_1133931695 4 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931695 16:10238088-10238110 CCTGCCAACGCAATCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133931695 Original CRISPR CCTGCCAACGCAATCCATCC TGG Intergenic
No off target data available for this crispr