ID: 1133931699

View in Genome Browser
Species Human (GRCh38)
Location 16:10238110-10238132
Sequence GATATTTTTTCGCAAAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133931696_1133931699 -5 Left 1133931696 16:10238092-10238114 CCAACGCAATCCATCCTGGATAT No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data
1133931691_1133931699 26 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data
1133931693_1133931699 5 Left 1133931693 16:10238082-10238104 CCAGGTCCTGCCAACGCAATCCA No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data
1133931694_1133931699 -1 Left 1133931694 16:10238088-10238110 CCTGCCAACGCAATCCATCCTGG No data
Right 1133931699 16:10238110-10238132 GATATTTTTTCGCAAAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133931699 Original CRISPR GATATTTTTTCGCAAAGCAA TGG Intergenic
No off target data available for this crispr