ID: 1133931700

View in Genome Browser
Species Human (GRCh38)
Location 16:10238111-10238133
Sequence ATATTTTTTCGCAAAGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133931691_1133931700 27 Left 1133931691 16:10238061-10238083 CCTGCTATTCGTCTACTTTAACC No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data
1133931693_1133931700 6 Left 1133931693 16:10238082-10238104 CCAGGTCCTGCCAACGCAATCCA No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data
1133931694_1133931700 0 Left 1133931694 16:10238088-10238110 CCTGCCAACGCAATCCATCCTGG No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data
1133931696_1133931700 -4 Left 1133931696 16:10238092-10238114 CCAACGCAATCCATCCTGGATAT No data
Right 1133931700 16:10238111-10238133 ATATTTTTTCGCAAAGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133931700 Original CRISPR ATATTTTTTCGCAAAGCAAT GGG Intergenic
No off target data available for this crispr