ID: 1133935618

View in Genome Browser
Species Human (GRCh38)
Location 16:10267002-10267024
Sequence AGCACTCATTTCTGTAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133935615_1133935618 6 Left 1133935615 16:10266973-10266995 CCTTACCACCACGATCAGTGGAA No data
Right 1133935618 16:10267002-10267024 AGCACTCATTTCTGTAGCAATGG No data
1133935613_1133935618 27 Left 1133935613 16:10266952-10266974 CCAAGCTAGGCTCTGTATCATCC No data
Right 1133935618 16:10267002-10267024 AGCACTCATTTCTGTAGCAATGG No data
1133935616_1133935618 1 Left 1133935616 16:10266978-10267000 CCACCACGATCAGTGGAAAATAA No data
Right 1133935618 16:10267002-10267024 AGCACTCATTTCTGTAGCAATGG No data
1133935617_1133935618 -2 Left 1133935617 16:10266981-10267003 CCACGATCAGTGGAAAATAAAAG No data
Right 1133935618 16:10267002-10267024 AGCACTCATTTCTGTAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133935618 Original CRISPR AGCACTCATTTCTGTAGCAA TGG Intergenic
No off target data available for this crispr