ID: 1133935977 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:10269710-10269732 |
| Sequence | AGGGCAATACATTCTGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1133935977_1133935981 | 21 | Left | 1133935977 | 16:10269710-10269732 | CCATCCTCAGAATGTATTGCCCT | No data | ||
| Right | 1133935981 | 16:10269754-10269776 | TCCTTGACCAAACTTTACTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1133935977 | Original CRISPR | AGGGCAATACATTCTGAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||