ID: 1133935977

View in Genome Browser
Species Human (GRCh38)
Location 16:10269710-10269732
Sequence AGGGCAATACATTCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133935977_1133935981 21 Left 1133935977 16:10269710-10269732 CCATCCTCAGAATGTATTGCCCT No data
Right 1133935981 16:10269754-10269776 TCCTTGACCAAACTTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133935977 Original CRISPR AGGGCAATACATTCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr