ID: 1133941949

View in Genome Browser
Species Human (GRCh38)
Location 16:10316760-10316782
Sequence GGTCCCATGGGAAGCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133941943_1133941949 26 Left 1133941943 16:10316711-10316733 CCTCAATTCACATGCTCATCTTT No data
Right 1133941949 16:10316760-10316782 GGTCCCATGGGAAGCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133941949 Original CRISPR GGTCCCATGGGAAGCCAAGC TGG Intergenic
No off target data available for this crispr