ID: 1133950198

View in Genome Browser
Species Human (GRCh38)
Location 16:10385271-10385293
Sequence GCAAACTCAAGGCTATGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133950188_1133950198 27 Left 1133950188 16:10385221-10385243 CCTCATGAAATCACAAGCAGCCA 0: 1
1: 0
2: 0
3: 24
4: 215
Right 1133950198 16:10385271-10385293 GCAAACTCAAGGCTATGGTGCGG 0: 1
1: 0
2: 2
3: 16
4: 117
1133950195_1133950198 -9 Left 1133950195 16:10385257-10385279 CCTGGGACAATTTAGCAAACTCA 0: 1
1: 1
2: 0
3: 8
4: 145
Right 1133950198 16:10385271-10385293 GCAAACTCAAGGCTATGGTGCGG 0: 1
1: 0
2: 2
3: 16
4: 117
1133950194_1133950198 7 Left 1133950194 16:10385241-10385263 CCAAGGCTGGCAGGTTCCTGGGA 0: 1
1: 0
2: 3
3: 44
4: 347
Right 1133950198 16:10385271-10385293 GCAAACTCAAGGCTATGGTGCGG 0: 1
1: 0
2: 2
3: 16
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133950198 Original CRISPR GCAAACTCAAGGCTATGGTG CGG Intronic
903046362 1:20566921-20566943 GGGAGGTCAAGGCTATGGTGAGG + Intergenic
906780291 1:48567347-48567369 GCAAAGTCAGGGCTGTGGTGTGG - Intronic
906877194 1:49552156-49552178 ACAGACTCAAGGCTGTTGTGAGG - Intronic
907237937 1:53064042-53064064 GCCAACTCAAGGCTCTGGGCAGG + Intronic
910873858 1:91859099-91859121 ACACACTCAAGGCTTTGCTGAGG - Intronic
913640089 1:120804358-120804380 GCAAGATCAAGGTTATGGTCAGG - Intergenic
914212424 1:145592271-145592293 GCAAGATCAAGGTTATGGTCAGG + Intergenic
914278387 1:146145980-146146002 GCAAGATCAAGGTTATGGTCAGG + Intronic
914539434 1:148596928-148596950 GCAAGATCAAGGTTATGGTCAGG + Intronic
914627247 1:149474700-149474722 GCAAGATCAAGGTTATGGTCAGG - Intergenic
920166233 1:204038045-204038067 GCAGCCTCAATGCTAGGGTGGGG + Intergenic
921781966 1:219175215-219175237 TCAAACTCAGGGCTTTGGTGGGG + Intronic
922022087 1:221715880-221715902 CCAAACCCAAGGCCCTGGTGGGG - Intronic
923050869 1:230390523-230390545 GCAAACTCAAGTCTAAGGTCGGG + Intronic
923356744 1:233163702-233163724 AGAAAGTCAAGGCTATAGTGAGG - Intronic
1066208519 10:33213380-33213402 GCAAACGCAAGGCGAAGGTGAGG - Exonic
1071405112 10:85322518-85322540 GCAAACTCAAGGATGGGGAGAGG - Intergenic
1073329263 10:102660292-102660314 GCAAGACCAAGGCTATGGTTTGG - Intergenic
1074407800 10:113194188-113194210 GCAAACTCAAAGCTTTAGGGAGG + Intergenic
1076666335 10:132095081-132095103 GCAGACTCAAGGCTGCTGTGGGG - Intergenic
1079385516 11:19975814-19975836 GCAAAGTCACTGCTAAGGTGGGG + Intronic
1080032521 11:27677036-27677058 GCAAGCCCATGGCCATGGTGAGG + Intronic
1080262525 11:30364929-30364951 GCCAATTCAAGGTTGTGGTGGGG - Intergenic
1081613313 11:44576441-44576463 TCAAACTCAAGGCTGGGGTCTGG + Intronic
1086804234 11:91219956-91219978 TTAAACTCAAGGCCATAGTGAGG + Intergenic
1089287282 11:117415716-117415738 GCCAAGACAAGGCTCTGGTGGGG + Intergenic
1091634097 12:2184342-2184364 GTAAACACAAGGGTATGGTCGGG - Intronic
1091667573 12:2430512-2430534 GCAAACTCAAGGCAAGTGTGAGG - Intronic
1100721994 12:97369013-97369035 GCAAACACCAGGCAATGCTGTGG - Intergenic
1102577431 12:113864755-113864777 ACAAACTAAAGCCTTTGGTGAGG + Intronic
1102618287 12:114173702-114173724 GGAGACTCATGGCTCTGGTGGGG - Intergenic
1113341260 13:109428378-109428400 GCCAACTCAAGGCTGTGGTGAGG + Intergenic
1118065913 14:62190012-62190034 GAAACATCAAGGCTATGGGGGGG - Intergenic
1122871301 14:104640286-104640308 GCAAACCCAAGCCGAGGGTGGGG - Intergenic
1123398073 15:19956553-19956575 GAAAACTCATGGCTGTGTTGGGG + Intergenic
1124112361 15:26803733-26803755 GCATCCTAAAGGCTATGATGGGG - Intronic
1124245049 15:28061667-28061689 GCAAAGTCAAGGTGCTGGTGAGG - Intronic
1125890097 15:43259191-43259213 GCAGACACAAGGACATGGTGTGG - Intronic
1126069029 15:44849619-44849641 ACAAACTGAGTGCTATGGTGAGG - Intergenic
1126089516 15:45039048-45039070 CCAAACTAAGTGCTATGGTGAGG + Intronic
1126089788 15:45041154-45041176 ACAAACTGAGTGCTATGGTGAGG + Intronic
1129387551 15:75204036-75204058 GAAAACACAAGGCTAGTGTGGGG - Intronic
1130886783 15:88099813-88099835 GGAAATTGAACGCTATGGTGGGG + Intronic
1133950198 16:10385271-10385293 GCAAACTCAAGGCTATGGTGCGG + Intronic
1144324483 17:14165605-14165627 GCACACACAAGGCTATTGTAGGG - Intronic
1145863565 17:28226662-28226684 GTAAGCTCAAGGATCTGGTGCGG + Intergenic
1147969798 17:44213135-44213157 GCAAACTCAAGGCTCTGGCCAGG + Intronic
1152530864 17:80918319-80918341 GCAGACTCCAGGCTCTGGGGTGG + Intronic
1153148465 18:2060308-2060330 CCAAACTCAAAGCTATAATGTGG - Intergenic
1155647060 18:28091819-28091841 GCAAACTAATGGCGGTGGTGGGG - Intronic
1157142318 18:45121921-45121943 GCAGAATTAAGGCTCTGGTGCGG + Intergenic
1160279128 18:77470785-77470807 CCCATCTCAAGGCTGTGGTGAGG + Intergenic
925429862 2:3782039-3782061 GCACAGTCACGGCTATGGTCTGG + Intronic
931906164 2:66846182-66846204 TAAAACTCAAGGCAGTGGTGGGG + Intergenic
933914831 2:86979510-86979532 GCAAATTCAAAGCTCTGGTGCGG + Intronic
934008163 2:87790390-87790412 GCAAATTCAAAGCTCTGGTGCGG - Intronic
934086217 2:88512077-88512099 GCATCGTCAAGGCTATGCTGTGG - Intergenic
934279646 2:91600633-91600655 TCAGACTCTAGGCTATGGGGTGG + Intergenic
935568574 2:104635380-104635402 TCAGACACAAGGCTATGGTCTGG - Intergenic
935994679 2:108756850-108756872 GCAAATTCAAAGCTCTGGTGCGG + Intronic
936130059 2:109829741-109829763 GCAAATTCAAAGCTCTGGTGCGG + Intronic
936214638 2:110541744-110541766 GCAAATTCAAAGCTCTGGTGCGG - Intronic
936423775 2:112396307-112396329 GCAAATTCAAAGCTCTGGTGCGG - Intronic
938194615 2:129315613-129315635 GCATACTCCAGGCTCTGGTGTGG + Intergenic
940269801 2:151877809-151877831 GCAAACTCAAGTCTATGAGAAGG + Intronic
946036422 2:216746085-216746107 ACAGACTCAGGGCTATTGTGGGG + Intergenic
946437161 2:219664890-219664912 GCCACCCCAAGGCTTTGGTGGGG - Intergenic
946501813 2:220257196-220257218 CCAAAATCAAGGTTCTGGTGGGG + Intergenic
948583623 2:239004663-239004685 GAAATCTCCAGGCTATGGTTAGG + Intergenic
1173224021 20:41151451-41151473 GCAAAGGGAAGGCGATGGTGGGG - Intronic
1176519705 21:7815381-7815403 ACAGACTCAGGGCTAGGGTGTGG - Intergenic
1177971817 21:27799262-27799284 GCAAATTCCAGGCTATGGGCCGG + Intergenic
1178214660 21:30580730-30580752 GCAAACTCTAGGCTAGCGAGAGG - Intergenic
1178653733 21:34445394-34445416 ACAGACTCAGGGCTAGGGTGTGG - Intergenic
1178971427 21:37181288-37181310 GCAACCACAAGGTTATGCTGAGG - Intronic
1179251301 21:39673691-39673713 GCTAATTCAGGGCCATGGTGGGG - Intergenic
1179310729 21:40193691-40193713 GGCATCTCAAGGCTATGGTCAGG + Intronic
1179981201 21:44896878-44896900 CCAGACTCCAGGCGATGGTGTGG - Intronic
1181341236 22:22181865-22181887 GAAAACTAAAGGCTGAGGTGAGG + Intergenic
1182112615 22:27734181-27734203 GGAAACTGAAGCCTAGGGTGGGG + Intergenic
951942090 3:28090592-28090614 CCAAGATCAAGGCTGTGGTGGGG - Intergenic
953941783 3:47105668-47105690 GTAATCTCAATGCTTTGGTGAGG + Intronic
955963954 3:64368929-64368951 GCAGACCCAAGTCTCTGGTGTGG + Intronic
956225174 3:66949575-66949597 ACAACCTCAAGGCCATAGTGAGG - Intergenic
956990050 3:74752109-74752131 GCAAAGTCAAGGCTGAGCTGGGG - Intergenic
958080243 3:88737635-88737657 GCAAACTCAAGGTGATGGCAGGG + Intergenic
959715771 3:109431315-109431337 ACAAACTCAGTGCTATTGTGGGG - Intergenic
960444060 3:117725836-117725858 GCAAAATAAAGGAGATGGTGAGG + Intergenic
966320790 3:178699255-178699277 GCAAAAGCAGGGCTCTGGTGAGG + Intronic
969989579 4:11248142-11248164 GCAAAATCAAGGATATGATCAGG - Intergenic
970197809 4:13570138-13570160 GCAAAGTCAAGGCAATGGTGAGG + Intronic
977496834 4:97786170-97786192 GCAAACTCATGTCTATGGCAGGG - Intronic
979094986 4:116536611-116536633 GAATAATCAAGGATATGGTGAGG - Intergenic
979388946 4:120104063-120104085 GCAAACTCAAGTCATTGGTATGG - Intergenic
979762651 4:124426021-124426043 GCAAAGCCAAGGCTATATTGGGG - Intergenic
980235775 4:130104102-130104124 GCATACTCCAAGCTATGATGAGG + Intergenic
983997639 4:174205027-174205049 GTCAACTCAAGGCAGTGGTGTGG - Intergenic
987694798 5:21314402-21314424 GAAATCTCATGGCTATTGTGTGG + Intergenic
989039391 5:37211527-37211549 GCAGCCTCAAGGCTATGCGGGGG + Intronic
991745435 5:69735039-69735061 GAAATCTCATGGCTATTGTGTGG - Intergenic
991752272 5:69820189-69820211 GAAATCTCATGGCTATTGTGTGG + Intergenic
991797002 5:70314768-70314790 GAAATCTCATGGCTATTGTGTGG - Intergenic
991824813 5:70610353-70610375 GAAATCTCATGGCTATTGTGTGG - Intergenic
991831591 5:70695311-70695333 GAAATCTCATGGCTATTGTGTGG + Intergenic
991889381 5:71314323-71314345 GAAATCTCATGGCTATTGTGTGG - Intergenic
992002021 5:72445174-72445196 GCAAACTGAAGGCAAAAGTGAGG - Intronic
992852637 5:80826010-80826032 CTAAACTCAAGGCTCAGGTGTGG + Intronic
993044914 5:82856159-82856181 GCCAACTAAATGCTATGGTTTGG - Intergenic
997712256 5:136015602-136015624 GAAAAGTCAAGGCAATGTTGTGG + Intergenic
1002994992 6:2274612-2274634 GTAAACTAAAGGCAATGGTGAGG - Intergenic
1005836113 6:29710799-29710821 GGAAAGTCAAGGCCTTGGTGCGG + Intergenic
1005856886 6:29869555-29869577 GGAAAGTCAGGGCTTTGGTGGGG + Intergenic
1013639300 6:112057719-112057741 GAAAACTGAAGGCAAGGGTGTGG + Intronic
1018205861 6:161436442-161436464 GCAAACTCAAGACTTTTTTGGGG + Intronic
1019934832 7:4247346-4247368 CCAAGCCCAAGGCTATGGTGCGG - Intronic
1021308711 7:19064395-19064417 GAAAACTAAAGGTTATGGGGAGG + Intronic
1026574189 7:71558213-71558235 GCAAAATCAAGGATATTATGTGG + Intronic
1032588748 7:133172882-133172904 GGTAGCTCAAGGCTATGGTTGGG - Intergenic
1034756043 7:153620324-153620346 GCAATCTCTAGTCTATTGTGTGG - Intergenic
1037494409 8:19424842-19424864 GCAGCCTCATGGCCATGGTGCGG - Intronic
1038688713 8:29742165-29742187 GCAAACTCAAGGGACTTGTGGGG + Intergenic
1039752721 8:40492947-40492969 GCAAAGACAAGGCTATGGCTTGG + Intergenic
1046550440 8:115709140-115709162 AAAAACGCAAGGATATGGTGAGG - Intronic
1048020310 8:130532228-130532250 GCTAACACAATGCTATGGTATGG - Intergenic
1051347169 9:16162637-16162659 GCAAAAGCAAGGCATTGGTGGGG + Intergenic
1056219969 9:84442301-84442323 GCAAACTCAAAATTATGGTTGGG + Intergenic
1061169151 9:128941909-128941931 GCCTCCTCAAGGCTATGTTGGGG - Exonic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1190999415 X:55644761-55644783 GGAACCTAAATGCTATGGTGGGG - Intergenic
1192281290 X:69688806-69688828 GCAAGGTCTAGGCTATGGAGAGG + Intronic
1195170097 X:102259196-102259218 TGAAACTAAAGGCCATGGTGAGG + Intergenic
1195188760 X:102427904-102427926 TGAAACTAAAGGCCATGGTGAGG - Intronic
1197162062 X:123334949-123334971 CCACACTCAATGCTAGGGTGAGG + Intronic
1198276597 X:135099849-135099871 GGAAACTGAAGGAAATGGTGTGG + Intergenic
1198554226 X:137775742-137775764 CCAAAATCAAGGTTTTGGTGGGG + Intergenic
1199510695 X:148618578-148618600 TCAATCTCAAGGCTATGATATGG - Intronic