ID: 1133950535

View in Genome Browser
Species Human (GRCh38)
Location 16:10387984-10388006
Sequence CACTTGAACCCGGAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77252
Summary {0: 1, 1: 17, 2: 730, 3: 13121, 4: 63383}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133950535_1133950545 17 Left 1133950535 16:10387984-10388006 CCTCCTCCCTCCGGGTTCAAGTG 0: 1
1: 17
2: 730
3: 13121
4: 63383
Right 1133950545 16:10388024-10388046 TTGCAAGTAGCTGGGATTATAGG 0: 6
1: 267
2: 7981
3: 73190
4: 178769
1133950535_1133950541 8 Left 1133950535 16:10387984-10388006 CCTCCTCCCTCCGGGTTCAAGTG 0: 1
1: 17
2: 730
3: 13121
4: 63383
Right 1133950541 16:10388015-10388037 GCCTCAGCCTTGCAAGTAGCTGG 0: 76
1: 3323
2: 93958
3: 206548
4: 245473
1133950535_1133950543 9 Left 1133950535 16:10387984-10388006 CCTCCTCCCTCCGGGTTCAAGTG 0: 1
1: 17
2: 730
3: 13121
4: 63383
Right 1133950543 16:10388016-10388038 CCTCAGCCTTGCAAGTAGCTGGG 0: 117
1: 4361
2: 107905
3: 219726
4: 257905

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133950535 Original CRISPR CACTTGAACCCGGAGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr