ID: 1133955925

View in Genome Browser
Species Human (GRCh38)
Location 16:10443854-10443876
Sequence GCTAGGACTGACAATTAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133955925 Original CRISPR GCTAGGACTGACAATTAGAG GGG Intronic
903344668 1:22676813-22676835 GCTAGGACCGTCCTTTAGAGGGG - Intergenic
910706211 1:90132345-90132367 GCTTGGGCTGACAAATGGAGGGG + Intergenic
913665405 1:121043711-121043733 TCTAGGACTCCCAATTTGAGAGG + Intergenic
914016802 1:143826982-143827004 TCTAGGACTCCCAATTTGAGAGG + Intergenic
914160984 1:145134029-145134051 TCTAGGACTCCCAATTTGAGAGG - Intergenic
914655412 1:149735523-149735545 TCTAGGACTCCCAATTTGAGAGG + Intergenic
916199922 1:162261228-162261250 GATAGGACTGATGCTTAGAGGGG - Intronic
919694115 1:200556121-200556143 CCTAAGACTGAGAACTAGAGTGG + Intronic
920736189 1:208534837-208534859 GCTAGGATTGACAATGAGTTAGG + Intergenic
921345359 1:214178250-214178272 GTAAGGACTGTCAAATAGAGAGG - Intergenic
923368808 1:233289766-233289788 GCTAGGACTGACTAGAACAGAGG + Intronic
924026542 1:239839205-239839227 GCTAGGACTGAAACTTGGATAGG + Intronic
1069789746 10:71012039-71012061 GCTAGAACTGAGACTCAGAGAGG - Intergenic
1070143448 10:73756157-73756179 GTGAGGACTGAAAATCAGAGTGG + Intronic
1081486088 11:43530433-43530455 GCTAGGGCGAACCATTAGAGTGG - Intergenic
1082201024 11:49367604-49367626 AGTAGGACAGGCAATTAGAGAGG + Intergenic
1085200256 11:74697550-74697572 GCTAGGATTGCAGATTAGAGGGG - Intronic
1085296448 11:75434312-75434334 GCTAGGAATGACACGCAGAGGGG - Intergenic
1086654653 11:89338601-89338623 AGTAGGACAGGCAATTAGAGAGG - Intronic
1089082723 11:115790539-115790561 GTTAGGAATGACTGTTAGAGTGG + Intergenic
1093181900 12:15976337-15976359 GCGAGGACTGAAAATTCTAGGGG - Intronic
1099816948 12:87661495-87661517 GGTGGGACTTAAAATTAGAGAGG + Intergenic
1100424672 12:94473133-94473155 GCAAAGACTGACCATTTGAGGGG + Intergenic
1102482473 12:113233228-113233250 GCCACGACTGCCATTTAGAGCGG - Intronic
1106762930 13:32884835-32884857 GCTAGGACTGACAAGTAGAATGG + Intergenic
1112174214 13:97005879-97005901 GCAAGGAATGAAAATTAGACAGG + Intergenic
1120646591 14:87081837-87081859 GCTATTTCTGACAACTAGAGGGG + Intergenic
1122368059 14:101208373-101208395 GCAAATACTGACAATTTGAGAGG - Intergenic
1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG + Intergenic
1128156054 15:65392536-65392558 CCCAGGACTGGCACTTAGAGTGG - Intronic
1131614577 15:94001664-94001686 GCAAGGACTAACCATAAGAGAGG + Intergenic
1133955925 16:10443854-10443876 GCTAGGACTGACAATTAGAGGGG + Intronic
1140875091 16:79143497-79143519 GCTAGGACAAACCATTTGAGTGG + Intronic
1144701378 17:17343141-17343163 GCTAGGGAGGACAATTAGACTGG + Intronic
1145839728 17:27984568-27984590 GCTTGGACAGAGAATTAGAGGGG - Intergenic
1148978235 17:51548228-51548250 GCAAGGATTGGCAATTAAAGAGG + Intergenic
1155119545 18:22804319-22804341 TCTAGGCCTGATAATTAGAGGGG - Intronic
1156668140 18:39433499-39433521 GTTAAAACTGAAAATTAGAGTGG + Intergenic
1164438637 19:28254293-28254315 GCCAGGACTGACACTCACAGGGG - Intergenic
925999080 2:9315654-9315676 GCCAGGACTGTCAATGACAGTGG + Intronic
931613361 2:64127830-64127852 GTTAGGACTGACCACTAGACAGG + Intronic
938075029 2:128327395-128327417 GCTGGGACTGCCAATGAGAGGGG + Intergenic
938191928 2:129291171-129291193 GGTAGGACTGACATTTACAAAGG + Intergenic
938989127 2:136610040-136610062 GCTATGCCAGACAAATAGAGCGG - Intergenic
939448172 2:142336227-142336249 GCTAGGCCTGAGAATTAAATTGG + Intergenic
939943041 2:148374782-148374804 GCTAGGCATGACAATTCAAGAGG - Intronic
940436910 2:153666447-153666469 GCTAGGACTCCCCATTGGAGTGG + Intergenic
941810250 2:169748477-169748499 GCTAGGAGTGACGATAAAAGCGG + Intronic
945044319 2:205768484-205768506 GCCATGACTGACAAGTACAGTGG + Intronic
945181166 2:207092574-207092596 AACAGGACTGACATTTAGAGAGG + Intronic
947150181 2:227107619-227107641 GCTAGGACTGACACTGGGTGTGG - Intronic
1169210849 20:3765635-3765657 GCCAGGAGTGACCCTTAGAGTGG + Intronic
1172745763 20:37207475-37207497 ACTAGGAATGATAATCAGAGGGG - Intronic
1177450498 21:21259145-21259167 GCTTGGACTTACAAAAAGAGTGG + Intronic
1177452262 21:21285716-21285738 GCTAGGACTCAGAATTATAGTGG - Intronic
1178282865 21:31298573-31298595 GGGAAGACAGACAATTAGAGAGG - Intronic
1185146399 22:49139185-49139207 GCTATAACTGAAAATGAGAGTGG - Intergenic
963994381 3:151690727-151690749 TCTGGGTCTGACAATTAAAGGGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
978600203 4:110419312-110419334 GCAGGGACTGACAATTAGAACGG + Intronic
979631690 4:122909329-122909351 TTTAGGACTGAGATTTAGAGAGG - Intronic
981153862 4:141411360-141411382 ATGAGGACTGAGAATTAGAGTGG - Intergenic
984326790 4:178265226-178265248 GCTAGGACTAAGAATTAAATTGG - Intergenic
984400889 4:179262247-179262269 GGTAGCACTGACAATTGTAGTGG + Intergenic
987120370 5:14761518-14761540 CCTAGGTCTGATAATTAAAGGGG - Intronic
1003340005 6:5211254-5211276 GCAGTGACTGACAATGAGAGAGG + Intronic
1004961175 6:20790684-20790706 GCTTACACTGACAATTAGAAGGG + Intronic
1009327500 6:62371574-62371596 GAAAGTACTGACATTTAGAGTGG - Intergenic
1010602476 6:77847329-77847351 GCTAGCACAGACAAATACAGAGG - Intronic
1017440991 6:154464206-154464228 GCTGGGACTGACTGTTAGGGTGG + Intronic
1018463070 6:164017492-164017514 GCTGGGACTGAGAATGACAGAGG - Intergenic
1020564373 7:9777566-9777588 GCTAGGCCTGACCATACGAGAGG + Intergenic
1027422022 7:78026067-78026089 GCTAGAACTGACAATAGGAAGGG - Intronic
1031871025 7:127090505-127090527 GCTATGTCAGACAAATAGAGTGG - Intronic
1034848244 7:154467686-154467708 GCTTGGACTGAAAAGGAGAGAGG - Intronic
1034863747 7:154622873-154622895 GGTAAGACAGACAATTAGATTGG - Intronic
1036680311 8:10867618-10867640 GCTAGGAATGACAGCTAGAAAGG + Intergenic
1037989128 8:23308142-23308164 CCTAGGCCTGACACTTAGAAGGG + Intronic
1040971828 8:53143433-53143455 GCTAGTCATGACAATTAGATTGG + Intergenic
1041814996 8:61960730-61960752 GCTACAACCCACAATTAGAGAGG - Intergenic
1043264221 8:78242720-78242742 GGTAGGACCAATAATTAGAGTGG - Intergenic
1047547967 8:125838624-125838646 ACTAGCTCTGACAATGAGAGAGG + Intergenic
1049271293 8:141697642-141697664 GCCAGGCCTGAGAATCAGAGAGG + Intergenic
1053368137 9:37538260-37538282 GCTAGGACAGGCAGTGAGAGAGG + Intronic
1055191845 9:73534057-73534079 GCGAGAACTGACAACTTGAGGGG + Intergenic
1058863151 9:109137074-109137096 GCTAGAAATGACAAATAGAAAGG - Exonic
1187833123 X:23403045-23403067 ACTAGCAATGACAATAAGAGAGG - Exonic
1188585893 X:31775032-31775054 GTTAGAACTGAAACTTAGAGAGG - Intronic
1190775912 X:53552176-53552198 GGGAGGACTGACAATAAGCGGGG - Intronic
1195970271 X:110465297-110465319 GCTGGGACAGAAAATTGGAGTGG + Intergenic
1198592993 X:138204836-138204858 GCTAGGACTTCCAATAAAAGTGG + Intergenic