ID: 1133966784

View in Genome Browser
Species Human (GRCh38)
Location 16:10537514-10537536
Sequence CAGTGGGGCTGGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2315
Summary {0: 1, 1: 1, 2: 28, 3: 229, 4: 2056}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133966784_1133966792 5 Left 1133966784 16:10537514-10537536 CCCACTGCACTCCAGCCCCACTG 0: 1
1: 1
2: 28
3: 229
4: 2056
Right 1133966792 16:10537542-10537564 CTCTCCGTCCCTCCTGTCACAGG 0: 1
1: 0
2: 4
3: 20
4: 312
1133966784_1133966793 6 Left 1133966784 16:10537514-10537536 CCCACTGCACTCCAGCCCCACTG 0: 1
1: 1
2: 28
3: 229
4: 2056
Right 1133966793 16:10537543-10537565 TCTCCGTCCCTCCTGTCACAGGG 0: 1
1: 0
2: 2
3: 24
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133966784 Original CRISPR CAGTGGGGCTGGAGTGCAGT GGG (reversed) Intronic
Too many off-targets to display for this crispr