ID: 1133969805

View in Genome Browser
Species Human (GRCh38)
Location 16:10559370-10559392
Sequence GCCACAGTGAGCATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133969805_1133969811 7 Left 1133969805 16:10559370-10559392 CCCAGCTCCATGCTCACTGTGGC 0: 1
1: 0
2: 0
3: 28
4: 291
Right 1133969811 16:10559400-10559422 CTGGGCACAAAGTCAGCATTTGG 0: 1
1: 0
2: 0
3: 16
4: 223
1133969805_1133969813 23 Left 1133969805 16:10559370-10559392 CCCAGCTCCATGCTCACTGTGGC 0: 1
1: 0
2: 0
3: 28
4: 291
Right 1133969813 16:10559416-10559438 CATTTGGCTCTCTCCGGAAATGG 0: 1
1: 0
2: 1
3: 3
4: 103
1133969805_1133969814 30 Left 1133969805 16:10559370-10559392 CCCAGCTCCATGCTCACTGTGGC 0: 1
1: 0
2: 0
3: 28
4: 291
Right 1133969814 16:10559423-10559445 CTCTCTCCGGAAATGGCAACAGG 0: 1
1: 0
2: 0
3: 3
4: 92
1133969805_1133969812 17 Left 1133969805 16:10559370-10559392 CCCAGCTCCATGCTCACTGTGGC 0: 1
1: 0
2: 0
3: 28
4: 291
Right 1133969812 16:10559410-10559432 AGTCAGCATTTGGCTCTCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133969805 Original CRISPR GCCACAGTGAGCATGGAGCT GGG (reversed) Intronic
900014153 1:137330-137352 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
900044016 1:492532-492554 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
900065426 1:727438-727460 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
900791378 1:4683242-4683264 GCCACAGTGTGCCTGGCACTGGG + Intronic
901182696 1:7352498-7352520 GCCACACACAGCCTGGAGCTGGG - Intronic
902512037 1:16971858-16971880 GCTACCCTGAGCATGGAGCCAGG - Intronic
902720641 1:18302002-18302024 GCCTCAGTCCCCATGGAGCTGGG + Intronic
903224130 1:21885303-21885325 GCTGCAGTGAGCAGGGAGCTGGG - Exonic
904562623 1:31408948-31408970 GCCACAGGGGGCCAGGAGCTGGG - Intergenic
905984056 1:42260765-42260787 GCCTCAGTGACCATAGAGATTGG - Intronic
906201266 1:43961889-43961911 GCCACAGTGAGTAGAGGGCTAGG - Intronic
907527538 1:55062761-55062783 GTCACAGTCAGCAGTGAGCTGGG + Intronic
907875601 1:58484120-58484142 ACCACAGTGAGTAAGGTGCTAGG + Intronic
912499116 1:110110211-110110233 GCAAGAGTGAACATGGGGCTGGG + Intergenic
915524302 1:156466718-156466740 GCCACAGTGTGCAGGGAGAATGG - Exonic
918210073 1:182342622-182342644 GCCTCACTGTGCATGGAGCTTGG - Intergenic
918407133 1:184222508-184222530 GCCAGAGTGGGCATGGGGCTTGG - Intergenic
918956853 1:191218740-191218762 GACACAGAGAGAAAGGAGCTGGG + Intergenic
920306181 1:205019616-205019638 GACACAGTGGCCATTGAGCTGGG + Exonic
920708300 1:208271409-208271431 GGCACAAGGAGCATGGGGCTGGG + Intergenic
920725334 1:208429609-208429631 GACACATTCAGCATGGAACTGGG - Intergenic
920728278 1:208458169-208458191 ACCACAGTGACCTTGGAGCCTGG - Intergenic
920851066 1:209628018-209628040 GCCACCGTGAGTAGGGGGCTTGG - Exonic
921219531 1:212963321-212963343 GCCCCAGTGGGCAGGGGGCTGGG - Intronic
922100275 1:222473221-222473243 GCCGCCGAGAGGATGGAGCTGGG + Intergenic
922734046 1:227970213-227970235 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
922734437 1:227971752-227971774 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
922734725 1:227972884-227972906 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
923542491 1:234898628-234898650 GGCACAGTGAGCAAGAAACTGGG + Intergenic
924343480 1:243054905-243054927 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
924496826 1:244598574-244598596 CCCACAGAGACCATGGAGATTGG + Intronic
1064000634 10:11661238-11661260 GCAGCATTGAGCATTGAGCTAGG - Intergenic
1064994013 10:21280674-21280696 GTTACAGTGAGCAGTGAGCTAGG - Intergenic
1065870874 10:29955535-29955557 GCAACAGCCAGCAGGGAGCTGGG + Intergenic
1066733224 10:38451534-38451556 GCCGCCGAGAGGATGGAGCTGGG - Intergenic
1068131293 10:52898245-52898267 GACATAGTGAGCATGGTGGTGGG - Intergenic
1070789162 10:79179537-79179559 ACCACAGTGGGCATGTGGCTGGG - Intronic
1073171292 10:101510999-101511021 GCCACACAGAGAATGGAGCAGGG - Intronic
1074835645 10:117290588-117290610 TCTACAATGAGCATGGAGCAAGG - Intronic
1075280886 10:121137280-121137302 TCCACAGTGAGTCTGGAGCAGGG + Intergenic
1075307117 10:121377940-121377962 GAGACAGTGAGCATGGGGATTGG - Intergenic
1075423561 10:122324481-122324503 GCCAGAGTTAGCATGAAACTGGG + Intronic
1076970353 11:129007-129029 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1077358882 11:2131003-2131025 GCCAGAGTGAGGAAGGAGTTTGG - Intronic
1078447503 11:11415548-11415570 GCCATATTGAACCTGGAGCTGGG + Intronic
1079318669 11:19431552-19431574 GCCAAAGTGAGGTTGGGGCTGGG + Intronic
1082259861 11:50070641-50070663 ACCACAGTGAGACAGGAGCTGGG + Intergenic
1082259949 11:50071168-50071190 GCCACAGTGAGGCAAGAGCTGGG + Intergenic
1083580001 11:63818710-63818732 GCATCAGTGAGGATGGAGCAGGG + Intronic
1083963309 11:66026462-66026484 GCCACAGTCTGCATTGAGCTTGG - Exonic
1084440925 11:69172747-69172769 GCCACAGGGAGCAGGGAGAGAGG + Intergenic
1084444884 11:69197756-69197778 GCCTCAGGGAAGATGGAGCTGGG + Intergenic
1085302393 11:75466248-75466270 GCCACAGTGAGCCTGTAGATGGG + Intronic
1087466064 11:98507957-98507979 GCCGCAGTGATCATGGACTTAGG - Intergenic
1088742357 11:112777481-112777503 GCTACAGTGGGCATGGGGCCAGG - Intergenic
1088909555 11:114180452-114180474 GCCACAGTGAGCATTGGACTGGG + Intronic
1089114516 11:116083452-116083474 CCCTCAGGGAGCTTGGAGCTGGG - Intergenic
1090038888 11:123273041-123273063 GCCACATGGAACCTGGAGCTGGG - Intergenic
1090473153 11:126997746-126997768 GATACTGGGAGCATGGAGCTTGG + Intronic
1090608472 11:128449407-128449429 CCCCCACTGAGCCTGGAGCTTGG - Intergenic
1090646032 11:128767255-128767277 TCCACAGTGAGCTTGGGGCCAGG + Intronic
1091978012 12:4842326-4842348 AGCACGGTGAGCCTGGAGCTAGG + Intronic
1095397062 12:41773215-41773237 GCCACATTGAGGTTGGAGGTGGG + Intergenic
1095945452 12:47751060-47751082 GCCACAGTGAGCAGGGCGTCAGG + Exonic
1096124171 12:49107507-49107529 GCAGCAGTGTGCATGGAGGTAGG - Intronic
1096794075 12:54063032-54063054 GCCACTGGGAGCATGAATCTGGG - Intergenic
1096794998 12:54071193-54071215 GCCAGAGTCAGCATGGTGCTGGG + Intergenic
1099561624 12:84183853-84183875 GCCACAGTCAGCAAGTAACTGGG - Intergenic
1102073206 12:110038830-110038852 GCCACAGTGAGCAGTGCCCTTGG - Exonic
1102737287 12:115173852-115173874 CCCACAGTGAGTATGAAGCCTGG + Intergenic
1103058007 12:117836691-117836713 GCCACAGTTGGCAAGGGGCTGGG - Intronic
1103218872 12:119226292-119226314 GCCACGGGGAGCTTGGAGCCTGG - Intergenic
1103477707 12:121230756-121230778 GCCAGATAGAGCATGGAGCTAGG + Intronic
1104591445 12:130087373-130087395 GCCACATTGAGCAGCCAGCTGGG - Intergenic
1105484585 13:20814606-20814628 GCCAGAGTGGCCATGGAGCAGGG - Intronic
1106010533 13:25816824-25816846 GCCACAGTGAGCCTGTGGCCTGG - Intronic
1107826514 13:44333290-44333312 GGCACAGTGAGCACTGGGCTTGG + Intergenic
1108579310 13:51815145-51815167 GACACAGTGAGGATGGAATTGGG + Intergenic
1110074201 13:71218000-71218022 GGCACAGAGTGAATGGAGCTAGG - Intergenic
1110248117 13:73350829-73350851 GCTACAATGAACATGGAACTAGG + Intergenic
1111759675 13:92445837-92445859 GCCACAGTGAGCTATGATCTTGG - Intronic
1113849578 13:113410511-113410533 GCCACAGTGTGCTGCGAGCTGGG + Intergenic
1113906913 13:113823597-113823619 GCCACAGTGAGGTCGGAGCAGGG + Intronic
1114082781 14:19216026-19216048 GACACAGTGAGCTTGGGGTTGGG + Intergenic
1117099122 14:52327657-52327679 CCCTCAGTGAGCATGGTACTTGG + Exonic
1118464800 14:66021245-66021267 GCCAGAGTTAGGTTGGAGCTGGG - Intergenic
1119757407 14:77128800-77128822 GCCACAGTGAGCCTGCTGGTGGG - Intronic
1119891645 14:78187034-78187056 GTGACAGTGAGCATGACGCTCGG + Intergenic
1120760890 14:88284262-88284284 GTCACATTGAGCATGCACCTGGG + Intronic
1121390354 14:93568289-93568311 GACAGAGTAAGGATGGAGCTTGG - Intronic
1121714387 14:96062610-96062632 GCAGCCGTGAGCAGGGAGCTGGG - Intronic
1121781359 14:96624416-96624438 CTCACAGTGAGCACGGAGCTGGG - Intergenic
1121826725 14:97016317-97016339 ACCACAGTGAGCTTGATGCTGGG + Intergenic
1121833253 14:97069828-97069850 GCCACAGACAGGATGGAGCTGGG - Intergenic
1126278611 15:46916076-46916098 GGCACAGTGACCATAGAGCAAGG + Intergenic
1128254575 15:66187374-66187396 GCCCCAGTGGACAGGGAGCTGGG - Intronic
1128469213 15:67937903-67937925 CCAACACTGAGAATGGAGCTTGG - Intergenic
1130513715 15:84609712-84609734 GCCCTAGTGAGAATGGAGCTGGG + Intronic
1130579827 15:85126049-85126071 GATACTGTGAGCATTGAGCTTGG - Intronic
1131061111 15:89405191-89405213 GCTGCAGTGAGGAGGGAGCTGGG + Intergenic
1131176279 15:90211599-90211621 GCCACAGTCAGCAGGAAACTGGG - Intronic
1131266781 15:90920168-90920190 GCCACAGTGACCCTGATGCTGGG - Exonic
1132525781 16:413828-413850 GTGACAGTGAGCTGGGAGCTCGG - Intergenic
1133969805 16:10559370-10559392 GCCACAGTGAGCATGGAGCTGGG - Intronic
1139115783 16:63949998-63950020 GCCACAGTGGGGAAGGAGTTAGG + Intergenic
1140930489 16:79623119-79623141 CCCACAGTGGGAAGGGAGCTGGG + Intergenic
1142248021 16:88978660-88978682 GCCACCGTGAGCATGTGGCTGGG + Intergenic
1142457188 17:63371-63393 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1142597763 17:1037814-1037836 GCCACCATGAGCTCGGAGCTTGG - Intronic
1143018877 17:3906044-3906066 CCCACAGTAAGTATGGAGCTGGG - Intronic
1143223382 17:5281011-5281033 GCCATAGAGAGAATGGATCTGGG + Intergenic
1143404414 17:6667745-6667767 GCCACAGAGGGCATTTAGCTTGG + Intergenic
1143564691 17:7714582-7714604 GCCACCGTGGACATGGGGCTTGG + Intergenic
1144016897 17:11204721-11204743 TCCACAGTGATGATGGAGCTAGG - Intergenic
1144783084 17:17817499-17817521 ACCCCAGAGAGCATGGGGCTGGG + Intronic
1144830449 17:18128183-18128205 GCCACAGGCAGCATGGAGGCAGG + Intronic
1145232433 17:21183895-21183917 GCAACAGAGAGGATGGAGATGGG - Intronic
1146868193 17:36356837-36356859 TCTAAAGTTAGCATGGAGCTGGG - Intronic
1146949044 17:36893078-36893100 CCCACAGTGACCATGGAGCAGGG + Intergenic
1147071067 17:37957455-37957477 TCTAAAGTTAGCATGGAGCTGGG - Intergenic
1147082594 17:38036981-38037003 TCTAAAGTTAGCATGGAGCTGGG - Intronic
1147098537 17:38160949-38160971 TCTAAAGTTAGCATGGAGCTGGG - Intergenic
1148226408 17:45900756-45900778 CTCACAGTGAGCAGGGAGCTGGG - Intronic
1149579821 17:57741820-57741842 GCTGCAGGGAGCATGGAGTTAGG - Intergenic
1150496136 17:65609259-65609281 GCCACAGAGAGAATCAAGCTTGG + Intronic
1150737548 17:67753289-67753311 GCCACAGTGGAAATGGAGCAGGG - Intergenic
1151182127 17:72336893-72336915 GCCACAGAGAGCTTGTGGCTTGG + Intergenic
1151962609 17:77414953-77414975 GCCACAATGTGGATGGACCTTGG - Intronic
1152225046 17:79088933-79088955 GCAACAAAGAGCACGGAGCTGGG - Intergenic
1153286353 18:3458475-3458497 ACCCCAGTGAGCAGGAAGCTGGG + Intronic
1153404450 18:4720640-4720662 GACACAGTGAGGCTTGAGCTGGG + Intergenic
1153797730 18:8640347-8640369 GGCACAGTGAGGTTGGAGCCAGG - Intergenic
1153832673 18:8937061-8937083 GCCACAGTGGGAAGGGAGGTTGG - Intergenic
1154194000 18:12253167-12253189 CCCCCTGTGAGCCTGGAGCTGGG + Intergenic
1156359350 18:36370492-36370514 CCCACAGTGAGCATGTAGGGTGG - Intronic
1156563425 18:38156147-38156169 GCTACAGGAATCATGGAGCTGGG - Intergenic
1158451456 18:57569700-57569722 GCCCTAGTGAGCATGGGGGTGGG - Intronic
1158471745 18:57743228-57743250 ACCACAGAGAGCACAGAGCTGGG - Intronic
1159571191 18:70113734-70113756 GCTACAGTATGCAAGGAGCTTGG + Intronic
1160647547 19:200476-200498 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1162477873 19:10911797-10911819 GCATGAGTCAGCATGGAGCTGGG + Intronic
1162815966 19:13194750-13194772 GCCCCCGGGAGCCTGGAGCTTGG + Intergenic
1164573401 19:29390353-29390375 GCTGCAGTGAGCTAGGAGCTAGG + Intergenic
1164594435 19:29524638-29524660 GCCACAGTGAGCCAGGGGGTGGG + Intergenic
1165037112 19:33041655-33041677 GCCCCTGTGAGCAGGGAACTTGG - Intronic
1167801506 19:51745929-51745951 GGCAAAGTGAGGAGGGAGCTGGG - Exonic
926061067 2:9805440-9805462 CCCACACAGAGCAAGGAGCTCGG + Intergenic
926327132 2:11795117-11795139 GCTACAGTGATGATGGAGTTTGG + Intronic
927520542 2:23695668-23695690 ACCACATTGAGCAGGTAGCTGGG - Exonic
927937267 2:27082931-27082953 GCCAATGTGAGCGGGGAGCTGGG + Exonic
928246298 2:29631425-29631447 GGAACAGTGAGCATGGAAATGGG + Intronic
928910050 2:36410885-36410907 GCCACATTGAGGAGGGAACTTGG + Intronic
930100061 2:47596471-47596493 GGCACAGTGATCATGGAGGGAGG + Intergenic
931115240 2:59159421-59159443 GCCACAGTTGGCATTGAGCAAGG + Intergenic
932497905 2:72155929-72155951 GCCCCTGTGAGCTTGGAGCTGGG - Intergenic
932781364 2:74560599-74560621 TCCACTGTGAGCATGGAGGGAGG + Intronic
932803608 2:74764413-74764435 GGCACAGAGAGGAGGGAGCTGGG + Intergenic
933636764 2:84716859-84716881 GCCAGGGTGAGGATGGAGCTGGG + Intronic
933835500 2:86242238-86242260 GCAGCAGTAAGCAGGGAGCTGGG + Intronic
935870284 2:107440711-107440733 TCCACAGTGACTATGGAGCAAGG + Intergenic
936086512 2:109473254-109473276 ACCACTGGGAGCCTGGAGCTGGG + Intronic
937164045 2:119795270-119795292 GCCACAGAGAGCCTGAAGCCTGG - Intronic
937220794 2:120342441-120342463 GCCTCATTTAGCATCGAGCTTGG - Intergenic
937458956 2:122068999-122069021 GCCCCATCAAGCATGGAGCTTGG - Intergenic
938493797 2:131780592-131780614 GACACAGTGAGCTTGGGGTTGGG - Intergenic
938772666 2:134513719-134513741 CCCTCAGGGAGAATGGAGCTTGG - Intronic
947028738 2:225768791-225768813 GCCACAGGGATCCTTGAGCTGGG + Intergenic
947130275 2:226915651-226915673 GCAACAGTGTGCATGGAGGTGGG + Intronic
1170969061 20:21101790-21101812 GCCACCGTGGGGATGGAGGTGGG + Intergenic
1171110028 20:22472423-22472445 GCCACTGTCATCATGGAGTTTGG - Intergenic
1173410740 20:42807476-42807498 GCCACAGAGAGCACAGGGCTCGG - Intronic
1173499109 20:43539518-43539540 GCCACAGGCAACATGGAGCTGGG + Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1175270968 20:57734010-57734032 GCCACAGTGAGAGAGGAGATTGG - Intergenic
1175523088 20:59615367-59615389 ACTACAGTGTGCATGGAGCATGG + Intronic
1176108387 20:63400010-63400032 GCCACAGTGAGTGAGGAGCAGGG - Intergenic
1176711076 21:10150104-10150126 GACACAGTGAGCTTGGGGTTGGG - Intergenic
1177830058 21:26128191-26128213 GCCACACTGAGCGTGTAGCTGGG - Intronic
1178250239 21:30996899-30996921 GACTCAGTTTGCATGGAGCTAGG - Intergenic
1178462821 21:32818472-32818494 GACACTGTGAGGATGGAGCAGGG - Intergenic
1179180889 21:39043925-39043947 GCCACAGTCCACATGGAGCTGGG - Intergenic
1180096135 21:45555930-45555952 GCCACGGTGCGCATGCAGCAAGG + Intergenic
1180497998 22:15906643-15906665 GACACAGTGAGCTTGGGGTTGGG - Intergenic
1180558832 22:16599665-16599687 GCCACTATGAGCAGGGAGTTGGG - Intergenic
1180919963 22:19516569-19516591 GCCCCCCTGAGCATGGAGCATGG + Exonic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1182077404 22:27504468-27504490 GCCACAGTTGGCAGGCAGCTTGG - Intergenic
1183230658 22:36579969-36579991 ACAACAGTGAGCATGGATCGTGG + Intronic
1183519264 22:38287096-38287118 GCAACAGTGGGCAGGGAGATTGG - Intergenic
1183659888 22:39213084-39213106 AGGACAGTGAACATGGAGCTGGG + Intergenic
1184380710 22:44143458-44143480 GCCACAGTCTGCACGCAGCTGGG + Intronic
1184494454 22:44829577-44829599 GCCACACTGCGCGTGCAGCTTGG + Intronic
1184833569 22:47006954-47006976 GCTTCAGAGAGCTTGGAGCTGGG + Intronic
1185162218 22:49236887-49236909 GCCCCAGTGATCCTGGAGCTGGG - Intergenic
950668779 3:14512915-14512937 GCCAGAATGGGCATGGGGCTGGG - Intronic
950711690 3:14817744-14817766 GCCTTAGTGGGAATGGAGCTGGG + Intergenic
953471320 3:43169131-43169153 GCCCCAGTGAAAGTGGAGCTAGG + Intergenic
954662041 3:52231484-52231506 GCCACAGTGAAAAAGGAGTTTGG - Exonic
954847268 3:53570863-53570885 GAAAAAGTGAGCTTGGAGCTGGG + Intronic
960055215 3:113272315-113272337 GTCCCAGAGAGCATGGAGATGGG - Intronic
961165897 3:124763672-124763694 TCCACAGTGTGCGTGGAGATAGG + Exonic
961342296 3:126235693-126235715 GCCACAATGATCATGCAACTAGG + Intergenic
962604968 3:137025514-137025536 GTCCCAGTGAACAAGGAGCTTGG + Intergenic
963357515 3:144228349-144228371 GCCACAATGTGGATGGAACTGGG + Intergenic
966437814 3:179908264-179908286 GCCACAGTCAGCGTGTAGCTGGG + Intronic
968370294 3:198219636-198219658 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
968605470 4:1533120-1533142 GCCACAGTGGCCAAGGGGCTTGG + Intergenic
969185362 4:5470414-5470436 GCCACAGAGAGCATGGCTATGGG + Intronic
970450664 4:16164053-16164075 GCCACAGAGATCCTGGAGCCTGG + Intronic
971420518 4:26469986-26470008 GCCTCATTGAACAGGGAGCTGGG - Intergenic
972221786 4:36964285-36964307 GCATCACTGAACATGGAGCTGGG - Intergenic
977865819 4:102026244-102026266 GTAAGAGTGAGCCTGGAGCTGGG - Intronic
981108024 4:140903558-140903580 GACACACTGTGCATGGATCTCGG - Intronic
982136475 4:152278382-152278404 GCCACAGGCAGCATGTAGGTAGG - Intergenic
982712115 4:158768673-158768695 CGCACAGCGAGCATGCAGCTAGG - Intergenic
985010710 4:185579751-185579773 CCCAAATTGAGTATGGAGCTGGG + Intergenic
986095924 5:4554154-4554176 GCCACTCTCAGCATGGAGCAGGG + Intergenic
986560203 5:9053229-9053251 GCCACAGGGAGCTTGAAGCGAGG + Intronic
986671510 5:10146842-10146864 GCCACAGTGCTTGTGGAGCTCGG + Intergenic
987012199 5:13778913-13778935 GCCACAGTGAGAGTGGTGGTTGG + Intronic
989503555 5:42198506-42198528 GCCAAAGTGAGCAGACAGCTTGG - Intergenic
996395987 5:123014586-123014608 GCTGCTGTTAGCATGGAGCTTGG - Intronic
998230780 5:140360360-140360382 GACACAGAGAGCAAGGAACTGGG + Exonic
999327732 5:150653549-150653571 GCCACCCTGAGCAGGGAGGTAGG - Exonic
999616403 5:153429319-153429341 CCCACACTTAGCATAGAGCTTGG - Intergenic
1000188444 5:158884478-158884500 TCAGCAGTGAGCATGGTGCTTGG - Intronic
1000645069 5:163751226-163751248 GGCACAGTTTGCATGGAGTTGGG - Intergenic
1001238157 5:170047133-170047155 GCCCAAGTGTGCATGGAGGTGGG + Intronic
1001449059 5:171810109-171810131 GCCTCTGTGATCAGGGAGCTGGG + Intergenic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002415211 5:179116906-179116928 GGCACTGTGAGCATGGTTCTTGG - Intronic
1002729827 5:181326397-181326419 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1006620555 6:35360976-35360998 GCCCCAGGGATCATAGAGCTCGG + Intronic
1007285419 6:40744127-40744149 AGCACAGGGAGCATGGAACTGGG + Intergenic
1007843763 6:44737626-44737648 GTTACAGTGAGCATGGGGATAGG - Intergenic
1013269754 6:108534780-108534802 ACCCCAGTTAGTATGGAGCTCGG + Intergenic
1013457096 6:110340184-110340206 GGCACAAGGAGGATGGAGCTAGG + Intronic
1013835525 6:114330612-114330634 ACCTCTGTGAGCGTGGAGCTGGG - Intronic
1016291873 6:142536083-142536105 GGCTCACTGAGCATGGAGCATGG + Intergenic
1019059455 6:169245184-169245206 TCCCCAGTGAGCAGGGAGCAGGG - Intronic
1019261792 7:86078-86100 GCCACAGTGTGCAGGGAAATGGG + Intergenic
1019992351 7:4701139-4701161 GCCGCAGGGAGCTTGGAGATAGG - Intronic
1022656961 7:32328507-32328529 AGCACAGTGAACATGGAGCGTGG - Intergenic
1022662895 7:32382849-32382871 GCGACAGTGAGCAAGGAGTAGGG - Intergenic
1022801746 7:33783241-33783263 GCCACAGTGAGGCTAGAGCAAGG + Intergenic
1022955386 7:35375609-35375631 GCCGCAGTTAACATGGAGCCAGG - Intergenic
1023401053 7:39793181-39793203 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1024074122 7:45810159-45810181 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1024232625 7:47374228-47374250 GCCACAGTGTGCTTGGAACCAGG + Intronic
1024648395 7:51386833-51386855 GCCACCGTGAGGCCGGAGCTGGG + Intergenic
1024648582 7:51387598-51387620 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1024648882 7:51388744-51388766 GCCACCGGGAGGCTGGAGCTGGG + Intergenic
1024648927 7:51388906-51388928 GCCACCGTGAGGCCGGAGCTGGG + Intergenic
1024649210 7:51390039-51390061 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1025052913 7:55743878-55743900 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1025053290 7:55745369-55745391 GCCACCGTGAGGGAGGAGCTGGG + Intergenic
1025175901 7:56802349-56802371 GCCACGGTGAGGAAGGAGGTGGG + Intergenic
1025176081 7:56803155-56803177 GCCACAGTGAGGCCCGAGCTGGG + Intergenic
1025176439 7:56804582-56804604 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1025695352 7:63771804-63771826 GCCACTGTGAGGGAGGAGCTGGG + Intergenic
1025695713 7:63773267-63773289 GCCACAGTGAGGCCCGAGCTGGG - Intergenic
1025695892 7:63774073-63774095 GCCACGGTGAGGAAGGAGGTGGG - Intergenic
1025912944 7:65842010-65842032 GCCACTGTGAAAAAGGAGCTGGG - Intergenic
1026229625 7:68471600-68471622 GGCACTGGGAGGATGGAGCTGGG + Intergenic
1026771202 7:73200932-73200954 GTCACAGTGAGTAAGTAGCTGGG + Intergenic
1027012070 7:74754329-74754351 GTCACAGTGAGTAAGTAGCTGGG + Intronic
1027075971 7:75191725-75191747 GTCACAGTGAGTAAGTAGCTGGG - Intergenic
1029305484 7:99616765-99616787 GCCACAGAGCGCCTCGAGCTGGG + Intergenic
1029935820 7:104423200-104423222 GCCTCACTGAGCAAGGTGCTTGG + Intronic
1030131654 7:106206910-106206932 TCCATAGAGAGCTTGGAGCTAGG + Intergenic
1030451593 7:109719541-109719563 GCCACAGTGAGGATGGGGGAGGG + Intergenic
1031893819 7:127324997-127325019 GCCACATTGGGCATGTGGCTGGG - Intergenic
1031971814 7:128070166-128070188 GCCACACTGAGGAAGGGGCTTGG - Intronic
1032051543 7:128653518-128653540 GCCACCGTGAGAGAGGAGCTGGG - Intergenic
1034618480 7:152438345-152438367 GCCACTATGAGCAGGGAGTTGGG + Intergenic
1034996033 7:155577798-155577820 GCTGCAGTGAGGATGGAGCGGGG + Intergenic
1035072651 7:156156740-156156762 GCCACAACCAGCCTGGAGCTTGG - Intergenic
1036169448 8:6468482-6468504 TCCACAAGGAGCAAGGAGCTAGG + Intronic
1036222089 8:6929579-6929601 GACACAGTGAGTGTGGACCTTGG + Intergenic
1036507778 8:9371204-9371226 GCCAAAGTAAGCATGGATTTAGG + Intergenic
1036818832 8:11922929-11922951 GGCACAGTGAGCAGGGACATCGG + Intergenic
1037383978 8:18317915-18317937 GTCACAGAGAGAATGCAGCTGGG - Intergenic
1038148784 8:24923487-24923509 AACACAGTTAGCATGGATCTGGG - Intergenic
1038483863 8:27919969-27919991 GCCACAGTGGGCTTTGAGCAGGG + Intronic
1038816868 8:30912997-30913019 CGCACAGTGAGCAGGCAGCTCGG + Intergenic
1039878002 8:41603802-41603824 GCCTCACTGAGCTGGGAGCTGGG - Intronic
1041935372 8:63326567-63326589 GCCCCAGTGGGCCTGGAGCAGGG - Intergenic
1046187027 8:110734742-110734764 GCCAGAGAGAGCCTGCAGCTTGG - Intergenic
1047916339 8:129587830-129587852 GCCACAGAGAGCATCGATCCAGG + Intergenic
1048301380 8:133253758-133253780 GCTACAGTGAGCAGTGAGCTGGG - Intronic
1048360986 8:133697010-133697032 CCCGCAGGGAGCATAGAGCTGGG - Intergenic
1049202543 8:141347319-141347341 GCCACTGTGATCATGGTGCATGG + Intergenic
1053014998 9:34656884-34656906 GGCACAGTGACCCTGCAGCTGGG + Exonic
1053306322 9:36986764-36986786 GCCACCGTGAGAATACAGCTCGG - Intronic
1053648072 9:40135799-40135821 GACACAGTGAGCTTGGGGTTGGG - Intergenic
1053757666 9:41328046-41328068 GACACAGTGAGCTTGGGGTTGGG + Intergenic
1054329043 9:63733744-63733766 GACACAGTGAGCTTGGGGTTGGG - Intergenic
1054536508 9:66240372-66240394 GACACAGTGAGCTTGGGGTTGGG + Intergenic
1055112057 9:72569664-72569686 GCTACAGTGTGCATGGAGAGAGG + Intronic
1056395108 9:86174817-86174839 GCAACAGGGAGGATGGAACTGGG - Intergenic
1056793419 9:89640488-89640510 TCCACAGAGCGCATGGAGCCCGG - Intergenic
1057430712 9:94991129-94991151 GCCACTGTGAGCATTGTGCAGGG - Intronic
1057575281 9:96237545-96237567 CCCACAGGGAGCATGGGGCTGGG - Intronic
1058996223 9:110301155-110301177 GCATCACTGAGCATGCAGCTGGG - Intergenic
1060519120 9:124283911-124283933 GCCCCATTGAGGATGGAGATTGG + Intronic
1061230604 9:129313625-129313647 GACACAGTGAGAATGGGGCCAGG + Intergenic
1061744204 9:132727857-132727879 GTCACAGTGAGCATAGGACTGGG - Intronic
1061811147 9:133163437-133163459 GCCACAGTGAGCGGAGAGCCGGG + Intronic
1062754239 9:138278909-138278931 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1202795834 9_KI270719v1_random:119093-119115 GACACAGTGAGCTTGGAGTTGGG - Intergenic
1203577799 Un_KI270745v1:21666-21688 GCCACCGTGAGGGAGGAGCTGGG - Intergenic
1190327894 X:49218044-49218066 GCCACAGTGGTCATGGGGCAGGG + Intronic
1190457521 X:50640408-50640430 GCCACAGTGAAAATGGAGGGGGG - Intronic
1195059183 X:101177456-101177478 GTCACAGCGAGCATTGAGCCAGG + Intergenic
1195246952 X:103003512-103003534 GACACAGTGTGCTTGGAGGTTGG + Intergenic
1195927251 X:110038405-110038427 GCCAAAGTGGGCATGGAGGGTGG - Intronic
1197699403 X:129587214-129587236 GCCACTGTGTGCAGGTAGCTTGG - Intronic
1198274484 X:135088169-135088191 GCCACAGTCAGCATGGCAGTGGG + Intergenic
1202381071 Y:24276848-24276870 GCCACCGAGAGGACGGAGCTGGG - Intergenic
1202489714 Y:25393278-25393300 GCCACCGAGAGGACGGAGCTGGG + Intergenic