ID: 1133970563

View in Genome Browser
Species Human (GRCh38)
Location 16:10564764-10564786
Sequence GGAAATGCAAACAGGCAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133970551_1133970563 18 Left 1133970551 16:10564723-10564745 CCAAATGGAAATAAACCACCAGG 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG 0: 1
1: 0
2: 0
3: 32
4: 304
1133970550_1133970563 21 Left 1133970550 16:10564720-10564742 CCACCAAATGGAAATAAACCACC 0: 1
1: 0
2: 1
3: 22
4: 186
Right 1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG 0: 1
1: 0
2: 0
3: 32
4: 304
1133970560_1133970563 -9 Left 1133970560 16:10564750-10564772 CCTCCAGGAGGGAAGGAAATGCA 0: 1
1: 0
2: 3
3: 22
4: 305
Right 1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG 0: 1
1: 0
2: 0
3: 32
4: 304
1133970558_1133970563 0 Left 1133970558 16:10564741-10564763 CCAGGGCAGCCTCCAGGAGGGAA 0: 1
1: 0
2: 7
3: 55
4: 389
Right 1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG 0: 1
1: 0
2: 0
3: 32
4: 304
1133970555_1133970563 3 Left 1133970555 16:10564738-10564760 CCACCAGGGCAGCCTCCAGGAGG 0: 1
1: 0
2: 4
3: 74
4: 453
Right 1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG 0: 1
1: 0
2: 0
3: 32
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133970563 Original CRISPR GGAAATGCAAACAGGCAGCT CGG Intronic
903098254 1:21001623-21001645 AGACAAGCAAACAGGCAACTAGG + Intronic
903383588 1:22912897-22912919 GAAAATGCAAGCTGGCAGCCGGG + Intronic
903472872 1:23599452-23599474 GGAAATGAACCCAGGCAGCCTGG - Intronic
904865478 1:33575442-33575464 GGAAGTGAAGACAGCCAGCTGGG + Intronic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
907338542 1:53716758-53716780 AGAAAGCCAAACAGGCAACTAGG + Intronic
909505265 1:76381091-76381113 AGTAAACCAAACAGGCAGCTTGG + Intronic
911771561 1:101749410-101749432 GGAAATGAATGCAGGCATCTTGG + Intergenic
912160513 1:106978792-106978814 TGAAATGCAATCAGCCAGCCTGG - Intergenic
912334621 1:108850698-108850720 GGAAATGGAAACAGGCAGTGTGG + Intronic
912437412 1:109671530-109671552 GGGAAGGCATCCAGGCAGCTGGG - Exonic
913205952 1:116538953-116538975 GGATATGCACTCAGGCAGCTGGG - Intronic
914234134 1:145792767-145792789 GGATATGCAGACAGGCAGATAGG + Intronic
915113088 1:153577143-153577165 GAGAAGGCAAACAGGCAGGTAGG + Intergenic
915220575 1:154371337-154371359 TGTAATGCAAACACCCAGCTAGG - Intergenic
916809375 1:168292121-168292143 GGAAAGCCAAACAGGCAGGTGGG - Intronic
917107631 1:171509313-171509335 AGAAATGTAAACAGGCAGTGTGG + Intronic
917605918 1:176629387-176629409 GGAAGTCCAAACATGCAGGTTGG + Intronic
918817049 1:189200282-189200304 GGAAATGCAGTCAGGCAGACTGG - Intergenic
919874152 1:201849718-201849740 GGTAATTCAAAAAGGCAGCTGGG - Intronic
920041390 1:203100010-203100032 GGGAATGCAGACAGGCAGGGTGG - Intronic
921927919 1:220728162-220728184 TGAAATCCACACGGGCAGCTGGG + Intergenic
922247165 1:223812143-223812165 TGAAAGGCAACCAGGTAGCTTGG + Intronic
922447175 1:225707381-225707403 AGACAGGCAAACAGGCAGTTGGG + Intergenic
922717183 1:227883850-227883872 GGATGGGCAAACAGGGAGCTAGG - Intergenic
923390609 1:233511419-233511441 GGAATTGTAAACAGGCATGTAGG - Intergenic
923662913 1:235974025-235974047 GGGAATGAAAACAGACAGCTTGG - Intergenic
923712530 1:236398584-236398606 GGAAATGAAAGGAGGCAGCACGG - Intronic
924199358 1:241642724-241642746 GGAAATGCAGCCAGTCAGGTGGG + Intronic
1063370191 10:5516168-5516190 GGCAAATCAAACAGGCACCTGGG + Intergenic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1064468248 10:15607558-15607580 GAAAATGAAAACAGACAGATGGG + Intronic
1066781295 10:38948897-38948919 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1067718060 10:48704660-48704682 AGCAGTGCACACAGGCAGCTGGG - Intronic
1068631303 10:59300817-59300839 GGAATTACAAAGAGGCATCTGGG + Intronic
1069999961 10:72368915-72368937 GGAACTGCAAGTAGGCAGTTAGG + Intronic
1071435827 10:85647399-85647421 TGAAATGCAGAAAGGCAGCGAGG + Intronic
1072673605 10:97449687-97449709 GGAAATGCAAAAAAATAGCTGGG - Intronic
1075236578 10:120736406-120736428 TGAGATGCAAAAAGGTAGCTTGG + Intergenic
1075820461 10:125303847-125303869 GTAACTGCAAACAGGCAGGAAGG + Intergenic
1075845116 10:125539083-125539105 GGGAATGAAAACAGGCAGCCAGG + Intergenic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1076906100 10:133361954-133361976 GTAAATTTAAACAGTCAGCTGGG + Intergenic
1078761330 11:14254133-14254155 GGCAATAGAAACAGGAAGCTGGG + Intronic
1079287943 11:19156731-19156753 GGAGATGGAGACAGGCAGGTAGG - Intronic
1079630022 11:22663053-22663075 GGAAAGGCAAAGGGGCAGCACGG + Intronic
1079837079 11:25348984-25349006 GGGAAAGCAAACAAGCAACTTGG - Intergenic
1080417524 11:32082810-32082832 GGAAATGCAGGCAGGCAGGCCGG - Intronic
1081939080 11:46925434-46925456 TGAAAAGCAGACAGTCAGCTAGG + Intergenic
1082036986 11:47652977-47652999 TAAAATGCAAACAATCAGCTGGG - Intergenic
1084975211 11:72793349-72793371 GTAAATGCAAACAGGCTGTTGGG - Exonic
1085172689 11:74462501-74462523 GAGAATGCCAACTGGCAGCTGGG + Intronic
1087153912 11:94882891-94882913 AGAAAGGCAAACAGAGAGCTTGG + Intergenic
1087928783 11:103951391-103951413 GGAAGAGCTAACAGGCAGTTGGG - Intronic
1088460094 11:110073862-110073884 GGAGATGCCAGCAGGCATCTAGG - Intergenic
1088772138 11:113045430-113045452 GGAAATGCACTCAGACATCTTGG + Intronic
1089303555 11:117513142-117513164 GGAAATGGATACAGGCGGCCCGG + Intronic
1089871011 11:121672715-121672737 GCTAATGCAGACAGGCAGCTGGG + Intergenic
1091272430 11:134327039-134327061 TGAACTGGACACAGGCAGCTTGG - Intergenic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1095971979 12:47908337-47908359 GGAAAAACAAACAGTCAGATGGG - Intronic
1096678982 12:53242288-53242310 GGGAGCTCAAACAGGCAGCTCGG - Intergenic
1096687323 12:53296917-53296939 GGATATAGAAACAGGGAGCTTGG + Intronic
1097062933 12:56299671-56299693 AGAAATGGAAACAGGCAGTTCGG + Intronic
1098288387 12:68932588-68932610 GGAAGAGCAGACAGGAAGCTGGG + Intronic
1100287270 12:93179065-93179087 TGAAATCCATTCAGGCAGCTTGG - Intergenic
1100737643 12:97554920-97554942 TGATATGAAAGCAGGCAGCTGGG + Intergenic
1100939519 12:99710732-99710754 GGAAATGCAAACAGGAACTTTGG - Intronic
1103570790 12:121843484-121843506 GGAAGTTCAAACAGGCAGCCTGG - Intronic
1104474675 12:129061623-129061645 CAAACTGCAAACCGGCAGCTAGG - Intergenic
1105052135 12:133064127-133064149 GGAAGTTCAAAGAGGCACCTAGG + Intergenic
1106310563 13:28550355-28550377 GGAAAGGAAGACAGGCAGCCAGG + Intergenic
1107268362 13:38584283-38584305 GGATTTGCACACTGGCAGCTTGG + Intergenic
1107652952 13:42562991-42563013 AGAACTGTAAACAGTCAGCTAGG + Intronic
1108602481 13:52006738-52006760 GGAAATGGAAAGAGGCATTTAGG - Intronic
1109826486 13:67728311-67728333 GGAAATGTCATCTGGCAGCTAGG + Intergenic
1110257378 13:73446362-73446384 GGAGGGGCAAACAAGCAGCTGGG + Intergenic
1111181347 13:84670542-84670564 GGGAATGAAAACAGGCATCAAGG + Intergenic
1112065930 13:95793040-95793062 GAAAATGCAAACAAGCCTCTGGG - Exonic
1113747740 13:112756690-112756712 AGAAAGGCAAAGAGGCATCTGGG - Intronic
1114446581 14:22793353-22793375 GGGAATGAATAAAGGCAGCTTGG - Intronic
1114711123 14:24779277-24779299 GGAGATGCAAACAAGGAGCTGGG - Intergenic
1116280790 14:42904081-42904103 GGAGACACAAACAGGCAGATAGG - Intergenic
1117045013 14:51804579-51804601 GGCAATGCTAACATGCAGCCAGG - Intergenic
1117677618 14:58170738-58170760 GGATATTCCAACAGGCATCTAGG + Intronic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1118345718 14:64939327-64939349 GGAAAAGGAAACAGGCAGAGGGG + Exonic
1119269537 14:73290084-73290106 GGAGATTCAAACAGGCTGCCGGG + Intronic
1119688882 14:76654967-76654989 GGAGAAGCAAACAGGAAGATGGG - Intergenic
1119814189 14:77550604-77550626 AGAAAAGAAAACAGTCAGCTGGG + Intronic
1120606215 14:86582077-86582099 GGAAATGCAAGTATGGAGCTTGG + Intergenic
1121830497 14:97047509-97047531 GGAAAAGCAAACAGACAGGCAGG - Intergenic
1124988628 15:34648467-34648489 GGAAATGCAAACAGAGAGGGAGG + Intergenic
1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG + Exonic
1127724633 15:61737120-61737142 GGCCCTTCAAACAGGCAGCTTGG - Intergenic
1130052425 15:80494979-80495001 TGACATGCAAACAGACTGCTTGG + Intronic
1130086643 15:80783249-80783271 AGAAATGCAAACATGTAGGTTGG + Intronic
1130647865 15:85744523-85744545 TGTAATGCAAACAGGCGACTGGG - Intronic
1131064652 15:89426460-89426482 GGAAATGCAAACCTTCAGCATGG - Intergenic
1131105173 15:89729048-89729070 GGCATTGCAAATAGGCAGCTAGG - Exonic
1131859409 15:96636532-96636554 GGCAATGCATCCAGGCTGCTTGG - Intergenic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1136868498 16:33777331-33777353 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1136902751 16:34057699-34057721 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1137022499 16:35442498-35442520 GGAAGTGCGAACAGCCAGCTGGG + Intergenic
1139366115 16:66434475-66434497 GGAGAAGGAAACAGGCAGCCAGG + Intronic
1140989216 16:80192079-80192101 GGTCATGCAAACAGGCAGTCAGG - Intergenic
1141364813 16:83432797-83432819 GGAAGTGCAAACAGGTTGCTAGG + Intronic
1203103681 16_KI270728v1_random:1338737-1338759 GGCAATGCAACCAAGCAGGTAGG + Intergenic
1203129833 16_KI270728v1_random:1623631-1623653 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1142953685 17:3505553-3505575 GCAAATGAAAAGTGGCAGCTGGG + Intronic
1143355955 17:6328664-6328686 GGAAAAGCAAACAGTCAATTGGG + Intergenic
1143386289 17:6532811-6532833 GGAAATGCCAACAAGCAGAAGGG + Intronic
1143722012 17:8819041-8819063 GGAAAGGGAGACAGCCAGCTGGG - Intronic
1144208795 17:12997593-12997615 GGACATGCAATAAAGCAGCTTGG - Intronic
1144550166 17:16233713-16233735 TGAAATGCAGACAGACAGATAGG + Intronic
1144707083 17:17376847-17376869 GGCACTGCAAACAGGCAGGTGGG - Intergenic
1145327738 17:21844514-21844536 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1145694552 17:26775889-26775911 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1147383397 17:40068791-40068813 AGAAAAAGAAACAGGCAGCTGGG - Intronic
1148345723 17:46902597-46902619 GGAAAAACAAACAGGCAGAGTGG + Intergenic
1149675450 17:58456961-58456983 AAAAATGAAAAAAGGCAGCTGGG + Intronic
1150293816 17:63997535-63997557 GAAAATCCAGACAGGAAGCTGGG - Intergenic
1150809785 17:68347380-68347402 GGAAGGGCAAACAGGCACCAAGG - Intronic
1151802597 17:76386647-76386669 GCAAATGGAAGCAGTCAGCTGGG - Intronic
1152240812 17:79160034-79160056 GGAAGGGCCAACAGGCAGCAAGG + Intronic
1203192375 17_KI270729v1_random:200753-200775 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1203201740 17_KI270730v1_random:190-212 GGCAATGCAACCAAGCAGGTAGG - Intergenic
1153387721 18:4517040-4517062 GGAAATGAATACAGGGAGTTTGG + Intergenic
1154517284 18:15186112-15186134 GGCAATGCAACCAAGCAGGTAGG + Intergenic
1155819534 18:30357174-30357196 GGAATTGCAAATAGACAACTAGG - Intergenic
1156723757 18:40102385-40102407 GAAAAAGCAAACAGGTATCTTGG + Intergenic
1157590877 18:48835935-48835957 ACAAATGCAAACAGGGAGCTGGG - Intronic
1158478460 18:57801764-57801786 GGCAATGCAACCAGGAAGATGGG + Intronic
1160039432 18:75332652-75332674 AGACATGCAAAAAGGCAGCAGGG + Intergenic
1160115609 18:76076394-76076416 TGAATTCCAAACAAGCAGCTTGG + Intergenic
1161512150 19:4677784-4677806 GAAAAAGTAACCAGGCAGCTGGG - Intronic
1165149320 19:33751663-33751685 GGACATGGAATCAGACAGCTCGG + Intronic
1165177167 19:33938940-33938962 GGACGTGCAAACACTCAGCTCGG - Intergenic
926148304 2:10410386-10410408 AGAAATGTAAACATGCAGCTGGG - Intronic
926385611 2:12332993-12333015 GAAAATGCAAAAAGTTAGCTGGG + Intergenic
926444764 2:12928753-12928775 AGAAAAACAAACAGGCAGATGGG + Intergenic
928180216 2:29063322-29063344 GCAAATGCGAGCAGACAGCTGGG + Exonic
928448763 2:31358927-31358949 GGAGATGAAAACATGCAGATTGG + Intronic
928556524 2:32432111-32432133 GGAGATCCAAAGAGGTAGCTGGG + Intronic
929568598 2:43006011-43006033 AGAAATCCGAAGAGGCAGCTAGG - Intergenic
930685989 2:54308748-54308770 GGAGCTGAAAACAGGCAGCATGG + Intergenic
931599836 2:63992113-63992135 CGGAATGGAAACAGGAAGCTTGG - Intronic
931790326 2:65658683-65658705 GGAAAAGCCATCAGGGAGCTGGG - Intergenic
932343888 2:70983307-70983329 GGAAAGGCATAGAGGCACCTGGG + Intronic
932453548 2:71831599-71831621 GGAAATGGGGACAGGCATCTGGG - Intergenic
932592400 2:73075270-73075292 GGATATGAAAACAGGCAGGTGGG + Exonic
933971214 2:87471252-87471274 AGAAATGTGAGCAGGCAGCTGGG + Intergenic
935118853 2:100162382-100162404 GGAAAGGCAAACAGGAACTTAGG + Intergenic
936322514 2:111478937-111478959 AGAAATGTGAGCAGGCAGCTGGG - Intergenic
936521879 2:113216566-113216588 GGAAATGCAATGTGACAGCTCGG - Exonic
936825476 2:116576669-116576691 GGAAATGTAATCTGGGAGCTAGG + Intergenic
937750423 2:125470500-125470522 AGAAATGCAAACAGGCATTCTGG - Intergenic
938410389 2:131059036-131059058 AGAAATGCAAAAAGGAAGCATGG + Intronic
938517617 2:132031035-132031057 GGCAATGCAACCAAGCAGGTAGG + Intergenic
939039464 2:137170671-137170693 GGAAAGGAAAAGAAGCAGCTGGG - Intronic
940348223 2:152650216-152650238 GGCAAGGCAAACAAGCAGTTTGG + Intergenic
941677334 2:168357517-168357539 GAAATTGGAAACAGGCTGCTGGG + Intergenic
942144918 2:173017688-173017710 GGAAAGGTAGACAGGCATCTCGG - Intronic
942326775 2:174782546-174782568 TAAAATGCAAACCGGTAGCTTGG + Intergenic
942511223 2:176704210-176704232 GGAAATGCAGAAAGGCAGAAGGG - Intergenic
943622939 2:190169600-190169622 GGAAATGCAAATATCCAACTTGG - Intronic
944666612 2:201964231-201964253 GGAAATGAAAACCTGCAGCTGGG - Intergenic
946018925 2:216626244-216626266 GGACATGAATCCAGGCAGCTTGG + Intergenic
946500776 2:220245161-220245183 GGAAAAGAAAACAAGCATCTAGG - Intergenic
947461339 2:230306837-230306859 GGAAAGGCAGACAGGCTCCTGGG + Intronic
948252041 2:236537078-236537100 TGCAATGCAGACAGGCAGCGTGG - Intergenic
948258992 2:236589273-236589295 GGACAATCAAACAAGCAGCTCGG + Intergenic
1169423049 20:5474905-5474927 GGAAATGGAACCAGCCAGATGGG - Intergenic
1169992252 20:11516447-11516469 GGACATGCACACAGGCCACTGGG + Intergenic
1170204361 20:13782495-13782517 AGAAATGCAATCAGGTAGGTTGG - Exonic
1170341699 20:15335906-15335928 GGAAATGCAAATAGACCCCTTGG - Intronic
1172066513 20:32224522-32224544 GCAATGGCAAACAGGCTGCTTGG + Intronic
1172620139 20:36313285-36313307 AGAAAGGCAGGCAGGCAGCTGGG - Intronic
1173135691 20:40436908-40436930 GGAAGTGAAAACAGCAAGCTAGG + Intergenic
1173983492 20:47242639-47242661 GCAAAAGCAAACAGCCAGCAGGG + Intronic
1176217123 20:63953404-63953426 AGAAATACACACAGGCAGCCGGG + Intronic
1181149818 22:20875233-20875255 GGAAATGAGAACAAGCAGCTTGG - Intronic
1181150083 22:20876969-20876991 GGAAATGAGAACAAGCAGCTTGG - Intronic
1181528230 22:23502106-23502128 GGAAGGGCACACAGGCAGGTTGG - Intergenic
1181565847 22:23736915-23736937 GGACATGCACACAGGCACCCAGG + Intergenic
1182072420 22:27473096-27473118 GGAAGTGACAAGAGGCAGCTGGG + Intergenic
1183422312 22:37719005-37719027 AGAAATACAAAAAGTCAGCTGGG - Intronic
950210754 3:11121128-11121150 GGAAAAGCAAATAGGCAGACAGG + Intergenic
950410183 3:12831117-12831139 GGGAGTGCAAACATGTAGCTTGG - Intronic
950563270 3:13748453-13748475 GGAATTACCAGCAGGCAGCTTGG - Intergenic
951926627 3:27915129-27915151 AGAAAGGCAAACAGGGAGCCAGG - Intergenic
953638539 3:44684433-44684455 GGAAGTGCAAAGAGGCATCAGGG - Intergenic
953782306 3:45881934-45881956 GGAAATGTAAACAGCCAACATGG - Intronic
955192615 3:56775471-56775493 GAGAATGCAACCAGGCTGCTGGG + Intronic
955580893 3:60420790-60420812 GCAAATGCAAACACTGAGCTAGG - Intronic
956018259 3:64907347-64907369 GGAAATGGAACCAGGGAGCAGGG - Intergenic
956236912 3:67082673-67082695 GCAAATGCCAACAGGCAGAGAGG + Intergenic
961371954 3:126436752-126436774 AGAAATACAAGCAGGCAGCTAGG + Intergenic
961910310 3:130308326-130308348 GGAACTGGAATCAGGCAGCCTGG - Intergenic
961965745 3:130900942-130900964 GGTAAAGCAAACATGCTGCTAGG - Intronic
962254468 3:133860946-133860968 GGTGATGCTAACAGGCAGCCAGG + Intronic
963874777 3:150462932-150462954 GGACAAGAAAATAGGCAGCTGGG - Exonic
963941968 3:151104629-151104651 GGAAATGAAAACATACAGGTAGG - Intronic
964459017 3:156901310-156901332 GGACACGCAAAGAAGCAGCTGGG + Intronic
964821459 3:160774981-160775003 GCAAATGCAATCAGACAGCTTGG - Intronic
964871654 3:161319515-161319537 AGAAATGTCATCAGGCAGCTAGG - Intergenic
965638892 3:170812472-170812494 GCAGATTCAAAGAGGCAGCTTGG - Intronic
965892848 3:173536352-173536374 GGAAATGGAAGCTGGGAGCTGGG - Intronic
966256079 3:177917824-177917846 GGAAAGGCAAACAGGCTCCTGGG + Intergenic
967486069 3:190032529-190032551 GGAAATGCAGGCAAGCAGGTTGG + Intronic
970313147 4:14803877-14803899 GGAAATGCAAATGGGTGGCTGGG + Intergenic
970552478 4:17196667-17196689 GTAAGTGTAAACAGGCAGCCAGG - Intergenic
970945687 4:21688820-21688842 GGAAAGGCAAGGAAGCAGCTGGG - Intronic
971244802 4:24917867-24917889 GGAAACGCAGAGAGGCAGCAGGG + Intronic
972519099 4:39836967-39836989 GGAAATGCAAAAAGTTAGCCAGG - Intronic
973729820 4:53812254-53812276 GGAAGTTCAAAAAGGCAGGTTGG + Intronic
983265989 4:165508549-165508571 AGAAATGCAAAGATGCCGCTGGG + Intergenic
983935889 4:173502297-173502319 CCAAATGCAACCAGGCAGGTGGG + Intergenic
985193044 4:187398563-187398585 GGAAATGCTGACAGGCTTCTTGG - Intergenic
985804267 5:2029695-2029717 GGCAGTGCAAACTGGCAACTTGG - Intergenic
986769371 5:10957844-10957866 GCCAAGGAAAACAGGCAGCTTGG + Intergenic
986934860 5:12870548-12870570 GGCAAAGCAGACAGGCAGCAAGG - Intergenic
986958557 5:13186690-13186712 GAAAATGCAAACAAGCAGGCAGG - Intergenic
989195595 5:38713418-38713440 GTAGATGAAAACAGGTAGCTGGG + Intergenic
989604423 5:43230300-43230322 GTAAATGGAAACAGCCACCTTGG - Intronic
989842816 5:46101612-46101634 GCAAATGCAAAAAGGTGGCTTGG + Intergenic
991422410 5:66454708-66454730 GGAAATGCAAAGTGGCACTTTGG - Intergenic
992186846 5:74252350-74252372 GGAAATGGGAAAAGGCACCTTGG - Intergenic
992497582 5:77308881-77308903 GGAAAAGTATACAGGCAACTGGG + Intronic
993165643 5:84351401-84351423 ATAGATGAAAACAGGCAGCTTGG - Intronic
994147140 5:96408272-96408294 GGAGACGCACACAGGCACCTCGG - Exonic
994352503 5:98763154-98763176 GGAAATAAAAGCAGGCAGCCCGG - Intergenic
995995342 5:118291675-118291697 GGAAAGGGAAGCAGGCAGCGAGG + Intergenic
996691719 5:126347563-126347585 GGAAAAGCAAACAAGGAGATCGG - Intergenic
996940491 5:128999660-128999682 GGAAAGGCAAGGAGGCAGATAGG - Intronic
997655037 5:135548252-135548274 GCTCATGCAAACAGGCACCTGGG - Intergenic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
998763547 5:145459029-145459051 GGAAATGCCATCAGCCACCTAGG + Intergenic
998785371 5:145703028-145703050 AGACATGCAAACAGAAAGCTGGG + Intronic
999045952 5:148469692-148469714 GGTTATGCAGACAGGAAGCTGGG - Intronic
999560964 5:152802412-152802434 AGAAATGCATAGAGGCACCTTGG + Intergenic
1000279410 5:159769213-159769235 GGAAAGGCAAATAGGGAGCCAGG - Intergenic
1001777527 5:174339768-174339790 GGCCATACAAACAGGCAGCCAGG - Intergenic
1001960526 5:175878100-175878122 GCAAATGAGAACAGCCAGCTTGG - Intronic
1002801956 6:531795-531817 AAAAGTGCCAACAGGCAGCTTGG + Intronic
1002887247 6:1308706-1308728 GGAAAGGTAAAGAGGCAGCTGGG + Intergenic
1003238732 6:4322792-4322814 GGAAAGGCAAAGAAGCTGCTGGG - Intergenic
1003969986 6:11290139-11290161 GGAAATGGACACAGGCAAATAGG - Intronic
1005422148 6:25662820-25662842 GTAAATGCAAACAGCAAGTTAGG + Intronic
1005808994 6:29502158-29502180 GGAAATGGAAAGAAGGAGCTGGG + Intergenic
1006916822 6:37600064-37600086 GGAAACTCAACCAGGCAGCAGGG + Intergenic
1007119430 6:39367886-39367908 GTAAAAGCACACAGACAGCTGGG + Intronic
1007518559 6:42433053-42433075 GGAAATACAACAAGGCAGTTGGG + Intronic
1009574175 6:65430743-65430765 AGAAATGCCATCTGGCAGCTAGG - Intronic
1009584917 6:65587992-65588014 GGAAAAGTAAACAACCAGCTGGG - Intronic
1010955716 6:82088746-82088768 GGAAATTCAAACAGACAAATAGG + Intergenic
1011216832 6:85014329-85014351 GGAAATGCATCTCGGCAGCTAGG + Intergenic
1011666964 6:89643690-89643712 GCAAAAGAAAACAGGCAGCTGGG + Exonic
1013613527 6:111819106-111819128 GGGAATGGAAAGAGGCAGTTTGG - Intronic
1014136699 6:117897717-117897739 GAAAATGCAATCAGGAACCTAGG + Intergenic
1014596314 6:123344851-123344873 GGAAATGCAAAAAGACAATTTGG - Intronic
1016092987 6:140001246-140001268 AGAATTGCAATCAGGCAGCATGG + Intergenic
1016749918 6:147621154-147621176 GTAAAAGCATACAGGAAGCTTGG - Intronic
1016914334 6:149230895-149230917 GGAACTGAAAACAGGCCCCTTGG + Intronic
1017169022 6:151438505-151438527 GGAGTTGTAAACTGGCAGCTCGG + Intronic
1018016419 6:159716343-159716365 GAAAATGAAAGCAGGCTGCTGGG - Intronic
1018795978 6:167185999-167186021 GGAAATGCAGACAAAGAGCTTGG + Intronic
1018899067 6:168042216-168042238 GGATGTGCAACCAGGCAGCCCGG + Intronic
1021270206 7:18575587-18575609 GGAAATGCAAAATGACACCTTGG + Intronic
1021357400 7:19668189-19668211 TGAAAGGCAAACAGGGAGCAAGG - Intergenic
1023912556 7:44566217-44566239 GGAAATGGGGAAAGGCAGCTGGG + Intronic
1024600296 7:50974433-50974455 GGGAATGGAAACAGGAAGATTGG + Intergenic
1024623004 7:51179118-51179140 GGAAATCCAAACAGGGACCCTGG + Intronic
1024807916 7:53168528-53168550 GGCAATGCAACCAAGCAGGTAGG + Intergenic
1025306691 7:57867979-57868001 GGCAATGCAACCAAGCAGGTAGG + Intergenic
1025877716 7:65501311-65501333 GGCAATGCAACCAAGCAGGTAGG + Intergenic
1026912803 7:74101344-74101366 AGAAATGAAGACAGTCAGCTGGG + Intronic
1026982911 7:74537112-74537134 AAAAATACAAACATGCAGCTGGG + Intronic
1027420616 7:78014548-78014570 GGACATGCACACAGCCTGCTAGG + Intergenic
1028377409 7:90159497-90159519 TGTAATGCATACAGGCACCTGGG + Intronic
1028997208 7:97114414-97114436 AGAAATGGAAGGAGGCAGCTAGG - Intergenic
1029709046 7:102289675-102289697 GGAAAAGCCAGAAGGCAGCTGGG + Intronic
1030854436 7:114535559-114535581 GAAAATAAAAACAGACAGCTGGG - Intronic
1031131061 7:117833669-117833691 GGAATTGCAAACAGGTAACTAGG - Intronic
1031884878 7:127235786-127235808 GGCAATGCTAACATGCAGCCAGG + Intronic
1032186201 7:129728727-129728749 GGAAATGCAAAGAGCCATCGTGG + Intronic
1032471895 7:132184798-132184820 GGAAATATAAGCAGGCAGCCAGG + Intronic
1033472626 7:141663639-141663661 GGAAGACCAAACAGGAAGCTGGG + Intronic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034670580 7:152854658-152854680 GGCAATGCAAGCACGCTGCTGGG - Exonic
1036575252 8:10021991-10022013 GGCAATGGAAAGGGGCAGCTGGG - Intergenic
1037407715 8:18561818-18561840 GGCAATGGGAACAGGCAACTTGG + Intronic
1037499367 8:19470583-19470605 GGAAGTGTTAACAGGTAGCTGGG + Intronic
1038172232 8:25146177-25146199 GGAAATGCAGACAGGACGGTAGG + Intergenic
1040080215 8:43276758-43276780 GAAAATGCAAACAGCCAGACCGG - Intergenic
1041803792 8:61827956-61827978 GGAAAGGCAGAAAGGCAGATGGG + Intergenic
1042994437 8:74679835-74679857 AGAATTGTAACCAGGCAGCTGGG - Intronic
1043043422 8:75291032-75291054 GAAAATACAAAGAGGCATCTTGG - Intergenic
1043512200 8:80960668-80960690 GCATATGCAAACAGGAAGGTTGG + Intergenic
1045036518 8:98180455-98180477 AGCCAAGCAAACAGGCAGCTAGG + Intergenic
1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG + Intergenic
1050159794 9:2706185-2706207 AGAAATGGAAATGGGCAGCTAGG + Intergenic
1051387471 9:16524468-16524490 GGAAATGGAAACAGGAATCAAGG - Intronic
1051522367 9:18003476-18003498 AGAAATGCAGACAGGCATGTAGG - Intergenic
1052226907 9:26100799-26100821 GGAAATTCATACAAGCATCTTGG + Intergenic
1052815572 9:33100333-33100355 AGAAATACAAAATGGCAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053397373 9:37786941-37786963 GGCCAGGCAAACAGGCAGGTCGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057122644 9:92590524-92590546 GGAAATGGAAACAGGGAGTGTGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057707706 9:97408683-97408705 GGAAATGCAAATTGACACCTCGG + Intergenic
1058365055 9:104199748-104199770 GGAAATGGAAAAGGGAAGCTGGG + Intergenic
1059147271 9:111911509-111911531 AGTAATGGAAACAGGCAGATGGG + Intronic
1059884448 9:118729776-118729798 GGAAATACCAACAGACAGATTGG - Intergenic
1060070257 9:120540920-120540942 GGAAATGGAAATAGGCGCCTTGG - Intronic
1061919645 9:133775896-133775918 GGAGATGGCAACAGGCAGCCTGG + Intronic
1061980711 9:134101942-134101964 GGAAAGGCATACAGGGAGCCTGG + Intergenic
1189112220 X:38303195-38303217 GAAAGTGCCATCAGGCAGCTTGG - Intronic
1189256469 X:39643643-39643665 GGAAAAGCCAACAGGCACGTAGG + Intergenic
1189445200 X:41074882-41074904 GGAGATGCAGAGAGGCAGGTTGG + Intergenic
1191257102 X:58284307-58284329 GGAGATGAAGACAGGCAGCCAGG - Intergenic
1192548983 X:72038524-72038546 GGAATTGGAAACAGACAGTTTGG - Intergenic
1192847255 X:74919217-74919239 GCAAATACAAACAGGCATTTAGG + Intronic
1193447880 X:81627270-81627292 GAAATGCCAAACAGGCAGCTGGG - Intergenic
1194111854 X:89843587-89843609 AGAAAGGAAAAAAGGCAGCTGGG + Intergenic
1194547626 X:95257360-95257382 GGATATGCAAGCAGGTAACTAGG + Intergenic
1196512126 X:116524077-116524099 GGAAATGCCATCTGGGAGCTAGG + Intergenic
1198507876 X:137319089-137319111 AGAGATGCATCCAGGCAGCTTGG - Intergenic
1200464514 Y:3498376-3498398 AGAAAGGAAAAAAGGCAGCTGGG + Intergenic
1201395590 Y:13544322-13544344 GGTAATTCATAGAGGCAGCTAGG + Intergenic
1201764116 Y:17563693-17563715 GGGAAAGGGAACAGGCAGCTAGG - Intergenic
1201837437 Y:18342297-18342319 GGGAAAGGGAACAGGCAGCTAGG + Intergenic