ID: 1133971490

View in Genome Browser
Species Human (GRCh38)
Location 16:10571381-10571403
Sequence TAAGGTGCCCCCAGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133971490_1133971492 -7 Left 1133971490 16:10571381-10571403 CCAACCACACTGGGGGCACCTTA 0: 1
1: 0
2: 0
3: 22
4: 108
Right 1133971492 16:10571397-10571419 CACCTTAAACCCCTGTGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133971490 Original CRISPR TAAGGTGCCCCCAGTGTGGT TGG (reversed) Intronic
901007290 1:6178263-6178285 GAAGGTGCCCCCAGTCTAGTAGG - Intronic
902620329 1:17647016-17647038 TCAGGGGGCCCCAGTGTGGCTGG + Intronic
903295348 1:22339875-22339897 TGTGGTGCTCACAGTGTGGTGGG - Intergenic
904890208 1:33773957-33773979 ACAGAAGCCCCCAGTGTGGTAGG - Intronic
905902346 1:41589759-41589781 TAAGCTGGCCCCAGGCTGGTGGG + Intronic
906184276 1:43849749-43849771 CAAGGTGCACTCAGTATGGTGGG - Intronic
907558390 1:55365827-55365849 TACGCTGCCCTCAGTGAGGTTGG - Intergenic
913263522 1:117022809-117022831 TAAGGAGCTCCCAGTCTGGTGGG + Intronic
918161067 1:181900228-181900250 CAACATGCACCCAGTGTGGTTGG - Intergenic
920139753 1:203800239-203800261 TAAGTTGCCCCATGTGTAGTTGG + Exonic
924463892 1:244283456-244283478 GACGATGCCCCCAGTGTTGTGGG + Intergenic
1065169524 10:23012504-23012526 TAAGGTGCCTTCAGAGTGATAGG - Intronic
1066380432 10:34896616-34896638 GAAGGAACCCCCAGGGTGGTGGG + Intergenic
1067347497 10:45447063-45447085 GAAGGTGCTTCCAGTGTGGCAGG + Intergenic
1067438965 10:46297564-46297586 TAAGCTGCCCCAAGTGAGTTGGG + Intronic
1067743355 10:48913725-48913747 TTCAGGGCCCCCAGTGTGGTGGG + Exonic
1068957029 10:62827474-62827496 TGAGGTGGCTCGAGTGTGGTTGG + Intronic
1072900589 10:99403445-99403467 TAAGGGGCTCCCAGTCTGGTGGG - Intronic
1074204237 10:111268317-111268339 TTAGGTGCCCCCAGTGTCCTAGG - Intergenic
1075600452 10:123763972-123763994 TAAAAAGCCCCCAGTGTGGGAGG - Intronic
1076307416 10:129474895-129474917 CAAGGGGCTCCCCGTGTGGTAGG + Intronic
1076491096 10:130862159-130862181 GATGGTGTCCCCAGTGTGGGTGG - Intergenic
1076873890 10:133206593-133206615 CAAGGAGGCCCCAGTGGGGTGGG + Intronic
1079480903 11:20878904-20878926 TAAGGTGCTTACAGTGTGCTGGG + Intronic
1082788456 11:57330639-57330661 TCAGGAGCCCCCAGTGGGGCTGG - Intronic
1082913370 11:58402924-58402946 AAATGTGTCCCCAGTGTGGATGG + Exonic
1083674149 11:64316200-64316222 TAACGTGCCCCCAGAGTGTAGGG + Exonic
1084285428 11:68128070-68128092 TAAGGGGCCCCCAGTCCTGTCGG + Intergenic
1084770525 11:71340222-71340244 GAATGTGCCGCCAGTGTCGTTGG - Intergenic
1085283316 11:75344758-75344780 TCAGGAGCCCCCAGTGTGATGGG + Intronic
1086295321 11:85360635-85360657 GAAGGAGCCTCCTGTGTGGTGGG - Intronic
1089291745 11:117441532-117441554 ACAGGTGCCCAGAGTGTGGTGGG + Intronic
1089906572 11:122046310-122046332 AAAGGAGCTCCCAGTGTGGTGGG + Intergenic
1091104512 11:132906134-132906156 AAAGGTGCCCCCATTCTAGTAGG - Intronic
1095717857 12:45367726-45367748 TAATGTGTCCTCAGTGTGATAGG + Exonic
1096694357 12:53339152-53339174 TGAGGGGCCCCCAGGGTGGTGGG - Intronic
1098497694 12:71155550-71155572 TAAGGTCCACACTGTGTGGTTGG - Intronic
1101074183 12:101111243-101111265 TAAGGAGCTCCCAGTCTGGTGGG + Intronic
1104747119 12:131217569-131217591 ACAGGTGCCTCCAGTGAGGTAGG - Intergenic
1106299934 13:28454140-28454162 TAAGGGGCCTGCAGTTTGGTAGG - Intronic
1108046274 13:46387310-46387332 TACGGTGGCCCCCGTGTGGGAGG - Exonic
1110347464 13:74465138-74465160 CAAGGTGCCCCCACTGTCCTCGG - Intergenic
1119041048 14:71274849-71274871 TAAGGTGTGCCCAGTGTGATGGG + Intergenic
1119968545 14:78943871-78943893 CAAGGTGCCTCCAATCTGGTTGG + Intronic
1121331490 14:93052555-93052577 AAAGGAACCCCCAGTGGGGTAGG + Intronic
1121595497 14:95158589-95158611 TTAGGTGCACCCTGTGAGGTAGG + Intergenic
1128835223 15:70804080-70804102 TAAGGTGGAGCCGGTGTGGTAGG + Intergenic
1129230222 15:74192924-74192946 CCAGGAGCTCCCAGTGTGGTGGG - Intronic
1129680643 15:77656710-77656732 GAAGCTGCCCCCAGTGTGTTAGG + Intronic
1131546217 15:93318011-93318033 AAAGATGCCGCCAGTGTGCTTGG - Intergenic
1133971490 16:10571381-10571403 TAAGGTGCCCCCAGTGTGGTTGG - Intronic
1134331639 16:13256619-13256641 TAAAGAGCCCCCAGTCTAGTAGG - Intergenic
1136105349 16:28026167-28026189 CAAGGTGCCCCCAGTCTGTGGGG - Intronic
1137972555 16:53000578-53000600 TGAGGTGCACCCAGGGTGCTGGG + Intergenic
1137977595 16:53044320-53044342 TAAGGAGCCCCCTGTGGGGTGGG + Intergenic
1142259187 16:89034651-89034673 GAAGGTGCCCCAAGTGTGCTAGG - Intergenic
1143669091 17:8383869-8383891 CAAGGCGCCCCCAGTGCTGTGGG + Intergenic
1144864752 17:18328211-18328233 CAAGATGCACCCAGTATGGTGGG - Exonic
1146923458 17:36728890-36728912 GATGGTGCCCGCAGTGTGGTCGG + Intergenic
1147418871 17:40312178-40312200 TTGGGTGCCCACAATGTGGTTGG + Intronic
1147923373 17:43932373-43932395 TTGGGTGCCCCCAGTGTGGGTGG - Intergenic
1148340604 17:46871296-46871318 CCTGGTGCCCCCAGTGTGGGTGG - Intronic
1149115258 17:53086383-53086405 CAAGGTGTCATCAGTGTGGTTGG - Intergenic
1155027849 18:21958427-21958449 CAAGGTGCCCCCAGTCTAGTGGG - Intergenic
1156779999 18:40839514-40839536 TAAAGTGCCCCCAGAGTTGAAGG + Intergenic
1158504709 18:58036347-58036369 TAAAGTGGCCCTAGAGTGGTAGG + Intergenic
1161482807 19:4519266-4519288 TAGGGTGCCCCCAGCTTGGCTGG - Intergenic
1161493561 19:4575656-4575678 GAAGGGGCCCCCAGTTTGCTGGG + Intergenic
1163786132 19:19275819-19275841 TCAGGTCCCACCAGTGTGGTAGG - Intergenic
1164090724 19:21949446-21949468 TAAGGTCCCCCCAATGAGTTTGG - Intronic
930151832 2:48067609-48067631 CAAGGGCCCCCTAGTGTGGTGGG - Intergenic
932894501 2:75626031-75626053 TAAGGTGACCTCTGTGTGGCTGG - Intergenic
934537956 2:95152036-95152058 TCACGTGCCTCCAGTGTGCTTGG + Intronic
935115953 2:100136354-100136376 GAAGGCGCGGCCAGTGTGGTAGG + Intronic
935862365 2:107347016-107347038 TAAGGTGTCTGCAGTGTGGAGGG + Intergenic
937247073 2:120500403-120500425 TAAGGGGCCCACAGTGCAGTGGG + Intergenic
938263693 2:129911885-129911907 TAAGAGGCCCCCACTGTGGCTGG - Intergenic
945985719 2:216352118-216352140 CAAGGTCCCTCCAATGTGGTTGG - Intronic
946941483 2:224774318-224774340 CAAGGTGCTCACAGTCTGGTAGG - Intronic
1172130544 20:32651967-32651989 TAAGGGGACCCCAGTCTGGAAGG + Intergenic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175913846 20:62416630-62416652 TGAGGTTCCCCCAGTGGTGTGGG + Intronic
1181804008 22:25364391-25364413 AGAGGTGACCCCAGTGTGGTGGG + Intronic
1182669631 22:31984871-31984893 CAAGGTGTTCCCAGTGTAGTTGG - Intergenic
1183145036 22:35982445-35982467 TCAGGGGCTCCCAGTGTAGTAGG - Intronic
1184087453 22:42273600-42273622 TAAAGAGCTCCGAGTGTGGTAGG - Intronic
1185038942 22:48494634-48494656 TGATCTGCCCCCAGTGTGGATGG + Intronic
950571470 3:13802920-13802942 TGAGGAGCCCCCAGTCTGGTTGG + Intergenic
954462816 3:50637302-50637324 CAAGCTGCTCCCAGGGTGGTAGG + Intronic
955056493 3:55460117-55460139 TAGGCTGCCCCAAGTGTGGCAGG + Intergenic
966334469 3:178853045-178853067 TGAGATGTCACCAGTGTGGTGGG + Intergenic
968741004 4:2331768-2331790 TAGGGTGTCCCCAGCCTGGTGGG - Intronic
969578327 4:8049150-8049172 CAAGGAGCCCCCTGTCTGGTGGG - Intronic
971014143 4:22470017-22470039 TAAGGTGCGCACACTGTGCTAGG - Intronic
976551190 4:86397217-86397239 TAAGAAGCACCCTGTGTGGTTGG + Intronic
976870743 4:89790617-89790639 TATGGTTCCCCCAGTGTGAGAGG + Intronic
982366713 4:154586681-154586703 GAAGGTACCCCCAGAGTGGAAGG - Exonic
983959755 4:173738206-173738228 TAAGGAGCCCACAGTGTGTTTGG - Intergenic
987194969 5:15517291-15517313 TAAGGGGCCCACAGTCTGGTGGG + Intronic
998496311 5:142592992-142593014 TAAGGTGCCTACTGTGTGCTAGG - Exonic
999431823 5:151531400-151531422 TAAGCTGGCCCCAGGGTGGAAGG + Intronic
999662703 5:153882436-153882458 TAGGGTGCCCCCACTGTCATTGG + Intergenic
1001148309 5:169204108-169204130 GAAACAGCCCCCAGTGTGGTGGG + Intronic
1003185326 6:3825455-3825477 TTAGGTGGCCGCACTGTGGTAGG + Intergenic
1006402244 6:33824707-33824729 TAAGGAGCTCCCAGTGTGTTTGG + Intergenic
1007395331 6:41574612-41574634 CAAGGAGGCCCCAGTCTGGTTGG + Intronic
1013243519 6:108267564-108267586 GAACATGACCCCAGTGTGGTTGG + Intergenic
1014419180 6:121219627-121219649 TAAGGTACTCCCACTGTAGTGGG + Intronic
1015670766 6:135687312-135687334 TTGGGTGACCCCAGTGTTGTCGG - Intergenic
1016207017 6:141480608-141480630 CAAGATATCCCCAGTGTGGTTGG + Intergenic
1017220430 6:151960123-151960145 TAATGTGCCCATAGTCTGGTTGG + Intronic
1018793409 6:167168089-167168111 TCAGCTGCCTCCAGTGGGGTGGG + Intronic
1018823304 6:167390289-167390311 TCAGCTGCCTCCAGTGGGGTGGG - Intergenic
1019341305 7:510331-510353 CAAGGTGCCCCTGGTGTGGCTGG - Intronic
1032467083 7:132152957-132152979 CCATGTGCCCCCAGTGTGCTGGG + Intronic
1037891801 8:22627576-22627598 ACAGGCTCCCCCAGTGTGGTTGG - Intronic
1038859851 8:31375418-31375440 TAGGGTGCCAGCAGTGTGGCGGG + Intergenic
1039443606 8:37612744-37612766 TCAGTTGGCCCCAGTGTCGTGGG + Intergenic
1046810136 8:118524387-118524409 GAAGGAGCAACCAGTGTGGTAGG - Intronic
1049601586 8:143510255-143510277 TGAAGTGCCCCCAGTCTGGTAGG - Intronic
1060069395 9:120533199-120533221 TATGGTGCTCTCAGTGTGGGAGG - Intronic
1061101038 9:128492585-128492607 TAGGGAGCCCCCAGTCTGATGGG - Intronic
1061799092 9:133104394-133104416 TGGGGTGCTGCCAGTGTGGTCGG + Intronic
1062561594 9:137144654-137144676 AAAAGTGTCCCCAGGGTGGTGGG + Intronic
1062561636 9:137144771-137144793 GAAAGTGTCCCCAGGGTGGTAGG + Intronic
1062561845 9:137145346-137145368 GAAAGTGTCCCCAGGGTGGTAGG + Intronic
1062561906 9:137145525-137145547 GAAAGTGTCCCCAGGGTGGTAGG + Intronic
1185959475 X:4533022-4533044 TAAGGTTTCCCTGGTGTGGTAGG + Intergenic
1190761562 X:53441823-53441845 CAAGGCGCTCCCAGTGCGGTTGG + Intergenic
1192177705 X:68896086-68896108 TCAGGGGCCCTTAGTGTGGTGGG + Intergenic
1200045730 X:153400433-153400455 TAGGGGGCGCCCAGTGTGGAAGG - Intergenic