ID: 1133974601

View in Genome Browser
Species Human (GRCh38)
Location 16:10591661-10591683
Sequence CATGTGGAGACTTATGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974601_1133974613 29 Left 1133974601 16:10591661-10591683 CCTACAGCATAAGTCTCCACATG No data
Right 1133974613 16:10591713-10591735 CTCCCCTAACCAGAGAGAGGAGG No data
1133974601_1133974612 26 Left 1133974601 16:10591661-10591683 CCTACAGCATAAGTCTCCACATG No data
Right 1133974612 16:10591710-10591732 AGACTCCCCTAACCAGAGAGAGG No data
1133974601_1133974604 -6 Left 1133974601 16:10591661-10591683 CCTACAGCATAAGTCTCCACATG No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974601 Original CRISPR CATGTGGAGACTTATGCTGT AGG (reversed) Intergenic
No off target data available for this crispr