ID: 1133974604

View in Genome Browser
Species Human (GRCh38)
Location 16:10591678-10591700
Sequence CACATGGTCACCCCCTCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974600_1133974604 12 Left 1133974600 16:10591643-10591665 CCTATGGCATGACAGGAGCCTAC No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data
1133974599_1133974604 18 Left 1133974599 16:10591637-10591659 CCAGTTCCTATGGCATGACAGGA No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data
1133974597_1133974604 22 Left 1133974597 16:10591633-10591655 CCAGCCAGTTCCTATGGCATGAC No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data
1133974596_1133974604 26 Left 1133974596 16:10591629-10591651 CCAACCAGCCAGTTCCTATGGCA No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data
1133974601_1133974604 -6 Left 1133974601 16:10591661-10591683 CCTACAGCATAAGTCTCCACATG No data
Right 1133974604 16:10591678-10591700 CACATGGTCACCCCCTCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974604 Original CRISPR CACATGGTCACCCCCTCCCG TGG Intergenic
No off target data available for this crispr