ID: 1133974607

View in Genome Browser
Species Human (GRCh38)
Location 16:10591690-10591712
Sequence TCTGGAGTGCTGCCACGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974607_1133974619 10 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974619 16:10591723-10591745 CAGAGAGAGGAGGCATCAGGTGG No data
1133974607_1133974617 7 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974617 16:10591720-10591742 AACCAGAGAGAGGAGGCATCAGG No data
1133974607_1133974621 15 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974607_1133974623 17 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974607_1133974620 11 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974620 16:10591724-10591746 AGAGAGAGGAGGCATCAGGTGGG No data
1133974607_1133974613 0 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974613 16:10591713-10591735 CTCCCCTAACCAGAGAGAGGAGG No data
1133974607_1133974612 -3 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974612 16:10591710-10591732 AGACTCCCCTAACCAGAGAGAGG No data
1133974607_1133974622 16 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974622 16:10591729-10591751 GAGGAGGCATCAGGTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974607 Original CRISPR TCTGGAGTGCTGCCACGGGA GGG (reversed) Intergenic
No off target data available for this crispr