ID: 1133974611

View in Genome Browser
Species Human (GRCh38)
Location 16:10591708-10591730
Sequence TCTCTCTGGTTAGGGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974611_1133974623 -1 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974611_1133974619 -8 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974619 16:10591723-10591745 CAGAGAGAGGAGGCATCAGGTGG No data
1133974611_1133974620 -7 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974620 16:10591724-10591746 AGAGAGAGGAGGCATCAGGTGGG No data
1133974611_1133974625 24 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974625 16:10591755-10591777 CTCAGAGCTGAAAAAATACTGGG No data
1133974611_1133974624 23 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974611_1133974621 -3 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974611_1133974622 -2 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974622 16:10591729-10591751 GAGGAGGCATCAGGTGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974611 Original CRISPR TCTCTCTGGTTAGGGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr