ID: 1133974614

View in Genome Browser
Species Human (GRCh38)
Location 16:10591715-10591737
Sequence TGCCTCCTCTCTCTGGTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974614_1133974622 -9 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974622 16:10591729-10591751 GAGGAGGCATCAGGTGGGACGGG No data
1133974614_1133974621 -10 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974614_1133974625 17 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974625 16:10591755-10591777 CTCAGAGCTGAAAAAATACTGGG No data
1133974614_1133974624 16 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974614_1133974626 24 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974626 16:10591762-10591784 CTGAAAAAATACTGGGAAGCTGG No data
1133974614_1133974623 -8 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974614 Original CRISPR TGCCTCCTCTCTCTGGTTAG GGG (reversed) Intergenic
No off target data available for this crispr