ID: 1133974615

View in Genome Browser
Species Human (GRCh38)
Location 16:10591716-10591738
Sequence ATGCCTCCTCTCTCTGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974615_1133974622 -10 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974622 16:10591729-10591751 GAGGAGGCATCAGGTGGGACGGG No data
1133974615_1133974623 -9 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974615_1133974624 15 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974615_1133974626 23 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974626 16:10591762-10591784 CTGAAAAAATACTGGGAAGCTGG No data
1133974615_1133974625 16 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974625 16:10591755-10591777 CTCAGAGCTGAAAAAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974615 Original CRISPR ATGCCTCCTCTCTCTGGTTA GGG (reversed) Intergenic
No off target data available for this crispr