ID: 1133974621

View in Genome Browser
Species Human (GRCh38)
Location 16:10591728-10591750
Sequence AGAGGAGGCATCAGGTGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974610_1133974621 10 Left 1133974610 16:10591695-10591717 CCGTGGCAGCACTCCAGACTCCC No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974611_1133974621 -3 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974606_1133974621 16 Left 1133974606 16:10591689-10591711 CCCCTCCCGTGGCAGCACTCCAG No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974605_1133974621 17 Left 1133974605 16:10591688-10591710 CCCCCTCCCGTGGCAGCACTCCA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974607_1133974621 15 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974614_1133974621 -10 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974608_1133974621 14 Left 1133974608 16:10591691-10591713 CCTCCCGTGGCAGCACTCCAGAC No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974603_1133974621 28 Left 1133974603 16:10591677-10591699 CCACATGGTCACCCCCTCCCGTG No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data
1133974609_1133974621 11 Left 1133974609 16:10591694-10591716 CCCGTGGCAGCACTCCAGACTCC No data
Right 1133974621 16:10591728-10591750 AGAGGAGGCATCAGGTGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974621 Original CRISPR AGAGGAGGCATCAGGTGGGA CGG Intergenic
No off target data available for this crispr