ID: 1133974623

View in Genome Browser
Species Human (GRCh38)
Location 16:10591730-10591752
Sequence AGGAGGCATCAGGTGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974607_1133974623 17 Left 1133974607 16:10591690-10591712 CCCTCCCGTGGCAGCACTCCAGA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974605_1133974623 19 Left 1133974605 16:10591688-10591710 CCCCCTCCCGTGGCAGCACTCCA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974608_1133974623 16 Left 1133974608 16:10591691-10591713 CCTCCCGTGGCAGCACTCCAGAC No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974614_1133974623 -8 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974611_1133974623 -1 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974610_1133974623 12 Left 1133974610 16:10591695-10591717 CCGTGGCAGCACTCCAGACTCCC No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974609_1133974623 13 Left 1133974609 16:10591694-10591716 CCCGTGGCAGCACTCCAGACTCC No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974615_1133974623 -9 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974606_1133974623 18 Left 1133974606 16:10591689-10591711 CCCCTCCCGTGGCAGCACTCCAG No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974603_1133974623 30 Left 1133974603 16:10591677-10591699 CCACATGGTCACCCCCTCCCGTG No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data
1133974616_1133974623 -10 Left 1133974616 16:10591717-10591739 CCTAACCAGAGAGAGGAGGCATC No data
Right 1133974623 16:10591730-10591752 AGGAGGCATCAGGTGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974623 Original CRISPR AGGAGGCATCAGGTGGGACG GGG Intergenic
No off target data available for this crispr