ID: 1133974624

View in Genome Browser
Species Human (GRCh38)
Location 16:10591754-10591776
Sequence GCTCAGAGCTGAAAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133974611_1133974624 23 Left 1133974611 16:10591708-10591730 CCAGACTCCCCTAACCAGAGAGA No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974615_1133974624 15 Left 1133974615 16:10591716-10591738 CCCTAACCAGAGAGAGGAGGCAT No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974616_1133974624 14 Left 1133974616 16:10591717-10591739 CCTAACCAGAGAGAGGAGGCATC No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974618_1133974624 9 Left 1133974618 16:10591722-10591744 CCAGAGAGAGGAGGCATCAGGTG No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data
1133974614_1133974624 16 Left 1133974614 16:10591715-10591737 CCCCTAACCAGAGAGAGGAGGCA No data
Right 1133974624 16:10591754-10591776 GCTCAGAGCTGAAAAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133974624 Original CRISPR GCTCAGAGCTGAAAAAATAC TGG Intergenic
No off target data available for this crispr