ID: 1133981465

View in Genome Browser
Species Human (GRCh38)
Location 16:10635958-10635980
Sequence TTCTGACCTCCTCTGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133981453_1133981465 26 Left 1133981453 16:10635909-10635931 CCTGCAGCGTCTGCGAGGGAACA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 177
1133981456_1133981465 -8 Left 1133981456 16:10635943-10635965 CCACCCACCAGGCCCTTCTGACC 0: 1
1: 2
2: 8
3: 104
4: 866
Right 1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133981465 Original CRISPR TTCTGACCTCCTCTGACTGG GGG Intronic
900091131 1:921185-921207 TTATGACCTCCTCCCTCTGGCGG + Intergenic
908897621 1:68918234-68918256 TTAGGACCTCCCCTTACTGGAGG + Intergenic
910218182 1:84863534-84863556 TCCTGACCTCCTTACACTGGAGG + Intronic
912693486 1:111822044-111822066 TTCTAACCTCCTCTGTATGTGGG + Intronic
915448754 1:155990117-155990139 TTCTGACTTCCTCTGACTTTGGG + Intronic
915979132 1:160409258-160409280 TTCTGGCCTCCTCTAATTGTTGG - Intronic
919913528 1:202126550-202126572 TTCTTCCCTCTTCTGGCTGGGGG - Intronic
920244786 1:204579401-204579423 TCCTCACCCCCTCTGTCTGGAGG + Intergenic
920699408 1:208206471-208206493 TTCTGAGCTTCTCTGAATGTTGG + Intronic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
921833124 1:219750445-219750467 TTCTGACCACCATTGACTGCAGG + Intronic
1063044913 10:2382003-2382025 TCCTCACTTCCTCTGACTGCGGG + Intergenic
1063104368 10:2980080-2980102 TTCTGACATCCTCTGGTTTGTGG + Intergenic
1063869903 10:10405737-10405759 TTCTGACACCCTCTACCTGGAGG - Intergenic
1065933669 10:30501180-30501202 TGCTTTCCACCTCTGACTGGTGG - Intergenic
1067088651 10:43255584-43255606 TCCTCACCTCCTCAGAGTGGTGG - Intronic
1067269726 10:44779897-44779919 TGCTGACCTCCTCCTACGGGAGG - Intergenic
1069809582 10:71148571-71148593 TCCTGACATCCTCTAACTCGGGG - Intergenic
1070550794 10:77489034-77489056 TTATGACCCCCTCTGCCTAGAGG - Intronic
1070931518 10:80264382-80264404 CTTTGACCTCCTCTGTCTCGAGG + Intergenic
1072308412 10:94130723-94130745 ATCTGTCTTCCTCTGTCTGGTGG - Intronic
1076246528 10:128951194-128951216 TGGGGTCCTCCTCTGACTGGTGG - Intergenic
1076539239 10:131203817-131203839 TTCAGACCTCCTCCAAGTGGGGG + Intronic
1078851816 11:15171200-15171222 CTCTGGCATCCTCTGAATGGAGG - Intronic
1080173460 11:29334150-29334172 CTCTGGCCTCCTCTGTCTGGGGG + Intergenic
1083083704 11:60120802-60120824 TTCTGCTCTTCTCTGAGTGGTGG - Intergenic
1083332614 11:61905998-61906020 TTCTGGCACCCTCTGACTGTGGG - Intronic
1083660406 11:64249414-64249436 TCCTGACCTCCTGTGGTTGGGGG + Intergenic
1088148784 11:106718063-106718085 TTCTGACACCATCAGACTGGAGG - Intronic
1088558473 11:111087715-111087737 ATATGACCTCATCTGACTAGTGG - Intergenic
1089166865 11:116484029-116484051 TTCTGTCCTCCCCTGAGAGGTGG - Intergenic
1091271347 11:134313789-134313811 GTCTGACCTGCTGTGACTGAAGG - Intronic
1094438948 12:30453552-30453574 TACTGACTTCCTCTGACTTCAGG + Intergenic
1095661305 12:44740339-44740361 TTCTGCCCTCCTCTGTGTGCTGG - Intronic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1098132869 12:67368542-67368564 TTATGTCCTCATCTGCCTGGAGG + Intergenic
1098581462 12:72104009-72104031 TTCTGACCTCCATTGTCTGGAGG + Intronic
1100358857 12:93857839-93857861 CTCAGTCCTCCTCTGTCTGGGGG - Intronic
1102185415 12:110944012-110944034 TACGAACCTCCTCTTACTGGGGG + Intergenic
1104074116 12:125374281-125374303 CTCTGAAGTCCTCTGTCTGGAGG + Intronic
1104307437 12:127622109-127622131 CTCTGTCCACCTCTGACTGGTGG - Intergenic
1104394785 12:128423303-128423325 TTCTGTCCTGCTTTGACTGGTGG + Intronic
1105470584 13:20690837-20690859 TTCAGACCTGCTATGCCTGGAGG - Intronic
1107200342 13:37707977-37707999 TCCTGACCTTTACTGACTGGGGG + Intronic
1108474720 13:50802345-50802367 TTCTGACCTACTCTGTTTAGTGG - Intronic
1109358129 13:61259545-61259567 TTCTGACATTTTCTGACTTGTGG + Intergenic
1112219349 13:97472079-97472101 TTCTAACTCCCTCTGTCTGGGGG - Intergenic
1113665362 13:112137279-112137301 TTCTGACCTCCTGTGAAATGTGG + Intergenic
1113751576 13:112780280-112780302 TGCCGACCGCCTCTGACTGGGGG - Intronic
1114528953 14:23383305-23383327 TTTTGTCTTCCTCTGTCTGGGGG + Exonic
1114534473 14:23414087-23414109 TCCTGTCCTCCTCCGTCTGGGGG + Exonic
1115428351 14:33287375-33287397 GCCTCACCTCCTCTGACTGTGGG - Intronic
1115766108 14:36625123-36625145 TTCTGGTCTGCTCTGCCTGGTGG - Intergenic
1120255589 14:82115467-82115489 TTCTTACCTCTTCTGACTTCTGG + Intergenic
1121971758 14:98364465-98364487 TTCTCCCCTCCTGTAACTGGTGG - Intergenic
1122614750 14:103009504-103009526 TTTTGAGCTCCTCTGATTGAAGG - Intronic
1123150725 14:106179166-106179188 TTCTGCCCTCCTGTCAGTGGTGG - Intergenic
1123202839 14:106682911-106682933 TTCTGCCCTCCTGTCAGTGGTGG - Intergenic
1125574218 15:40744383-40744405 TTCTGACCTCCTAGAACTGCTGG + Intronic
1125763854 15:42119710-42119732 TTCTGAGCCCCTCTGTCTGTCGG + Intergenic
1127342487 15:58062429-58062451 TACTGACCGCCCCTGACTGCAGG - Intronic
1128222500 15:65979223-65979245 CTGTGACCTCCTGGGACTGGGGG - Intronic
1128774865 15:70312602-70312624 TTTTCTCCTCCTCTGACTGATGG - Intergenic
1129416697 15:75387191-75387213 TTCTCAACTCCTTTAACTGGAGG - Intronic
1129565829 15:76622684-76622706 TTGTGACCTCATCTGAAAGGTGG + Intronic
1129820975 15:78601789-78601811 TTCTGTCCTCCTCTCCCTGACGG - Exonic
1130597657 15:85258270-85258292 TTCTGACCTCCAGTGAGTAGAGG - Intergenic
1132936929 16:2486027-2486049 TGCTGCCCTCCCCTGCCTGGCGG + Intronic
1133015123 16:2936302-2936324 TCCTGACCTCTTCTGTCTCGTGG + Intronic
1133141976 16:3751875-3751897 CTCTGCCCTGCTCTGATTGGTGG - Intronic
1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG + Intronic
1135421286 16:22307257-22307279 TTCTGAGATCACCTGACTGGGGG - Intronic
1139602769 16:67996725-67996747 GTCTGACCTCCTGGGACTTGGGG + Intronic
1141400472 16:83742795-83742817 GTCTGTCCTCCTCTGTCTGCAGG + Intronic
1142181597 16:88673776-88673798 CTCTGAGCTCCTCTGAGTCGTGG + Intergenic
1144886229 17:18464364-18464386 TTCTGCCCACATCTGACTGTGGG + Intergenic
1145145979 17:20480005-20480027 TTCTGCCCACATCTGACTGTGGG - Intergenic
1146289585 17:31598075-31598097 ATCTGCCCTCCTGTGACTGCCGG + Intergenic
1146967819 17:37047776-37047798 TTATGGGCTCCGCTGACTGGTGG + Intronic
1148153981 17:45412254-45412276 TCATCACCTCCTCTCACTGGGGG - Intronic
1149801146 17:59568686-59568708 TTTGGACCTCCACTGACTGTAGG + Intronic
1150036967 17:61812123-61812145 TTCTGACCTCCTGACACTGCTGG - Intronic
1152093135 17:78257848-78257870 TTCTGAGCTCCTCTGTCCGTGGG + Intergenic
1154052018 18:10970136-10970158 ATCTGACCCCCTCTACCTGGGGG + Intronic
1155154150 18:23144183-23144205 TTCAGCCCTGGTCTGACTGGAGG + Intronic
1156839168 18:41590994-41591016 TTCTGGCCTCTGCTGAGTGGTGG - Intergenic
1157099657 18:44717714-44717736 TTCTTCCCTCCTCTCACTGGTGG + Intronic
1157662770 18:49460316-49460338 CCCTGACCCCCTCTGACAGGAGG + Intronic
1158635724 18:59155173-59155195 TTCTGACCTATTCTGACTTGAGG + Intronic
1161770539 19:6228583-6228605 TTCTCTGCTCCTCTCACTGGGGG - Intronic
1162578967 19:11516186-11516208 TTGTGACCTCCTGGGACTTGGGG - Intronic
1164723063 19:30445878-30445900 TTCTTTCCCCCCCTGACTGGAGG + Intronic
1164905440 19:31963902-31963924 TTCTGAGCTCTTCAGACTAGAGG + Intergenic
1165461315 19:35945754-35945776 GTCTGAGCTCCTCAGCCTGGAGG - Exonic
925883792 2:8376786-8376808 TTTTGCCCTCCTCAGAATGGAGG + Intergenic
925920254 2:8633245-8633267 TTCTGCCTTCCTCTGGCAGGTGG - Intergenic
926386211 2:12338150-12338172 TTCTTGCCTCCGCTGACTGCTGG - Intergenic
930326312 2:49923287-49923309 TTCTATCCTACTCTGACTGTAGG + Intronic
930799922 2:55433359-55433381 TTTTGACCTCCTATGAATCGTGG + Intergenic
931131194 2:59338122-59338144 TCCTGACCACCTCTGGCTGAGGG + Intergenic
931533495 2:63245039-63245061 ATCTGACCGCCTGTGACAGGTGG + Intronic
937462362 2:122100628-122100650 TGCTGACCTCAGCTCACTGGTGG - Intergenic
939486179 2:142814038-142814060 CTCAGACCTCCTCTGACAGCTGG + Intergenic
940116767 2:150218287-150218309 TTCTTAACTCCCTTGACTGGTGG + Intergenic
941898094 2:170650960-170650982 TTATGACTTCTTCTGACTCGTGG + Intronic
942427942 2:175879112-175879134 TTTTGAGCTCCTGTGACTGTAGG + Intergenic
945129732 2:206557743-206557765 TTTTGTCCTCCACAGACTGGGGG - Intronic
948625533 2:239265910-239265932 TACTGACCTCCTGGGCCTGGTGG + Intronic
948987063 2:241532357-241532379 TTGTGGCCTCCACAGACTGGAGG - Intergenic
1173431375 20:42989869-42989891 GTGTGACCTTCTGTGACTGGAGG - Intronic
1175224265 20:57435831-57435853 TTCTGTCCCCTTCTGCCTGGCGG + Intergenic
1175629975 20:60527673-60527695 GCCTGACCTCCTCTGACAAGTGG - Intergenic
1177007038 21:15686333-15686355 CTCTGAACTCCTATGAGTGGTGG - Intergenic
1179553694 21:42159524-42159546 GTCTCAGCTCCTATGACTGGAGG + Intergenic
1181975325 22:26724769-26724791 TTCTGCCCTCCTGAGACTGCAGG + Intergenic
1183322805 22:37175568-37175590 ATCTGAGCTCCTCTGAGTGTCGG - Intergenic
1184655719 22:45941117-45941139 TTTTCACCTCCTCTACCTGGCGG - Intronic
1185413981 22:50699843-50699865 TTCTGCCTTGCTCTGACTGGTGG + Intergenic
951753452 3:26062363-26062385 TGCTGCACTCCTCTGACTGCTGG + Intergenic
952815289 3:37442237-37442259 TTCTGACCTAATCTGCCTGTGGG - Intergenic
953519185 3:43624885-43624907 TTCTGACCTCAGTTGACTGAAGG + Intronic
954135086 3:48578734-48578756 TTCTGACCTTCTTTGCCTTGGGG - Intronic
959566380 3:107836546-107836568 TGCTCACCTGCTCTGACTGGTGG - Intergenic
960241581 3:115348580-115348602 ATCTAACTTCCTCTGTCTGGAGG - Intergenic
961266522 3:125647536-125647558 TCCTAACCTCACCTGACTGGTGG - Intergenic
961433652 3:126901282-126901304 TTTTGCCGTCCTCTGACGGGAGG + Intronic
964284808 3:155106633-155106655 TTCTGACTTTCTCTGAATTGTGG + Intronic
964624165 3:158743061-158743083 TTCTGTGCTCCCCTTACTGGTGG + Intronic
965736734 3:171828350-171828372 ATCTCACCTCCTATGACTGTAGG - Intergenic
966971416 3:185048821-185048843 TTCTGGCCTGCTCTCTCTGGAGG - Intronic
969155745 4:5208260-5208282 TTCTGACTCCCTGTGGCTGGAGG - Intronic
969889089 4:10243161-10243183 TCCTGAGTTCCTCTGACTTGAGG + Intergenic
970627362 4:17902310-17902332 ATCTAACCTCCTCTGACTGCAGG - Intronic
970969386 4:21963803-21963825 TTATTCCCTCCTCTGAGTGGTGG - Intergenic
972028025 4:34411926-34411948 TCCTGACCACCAGTGACTGGCGG - Intergenic
976168770 4:82282623-82282645 TTCTGTCCTTCTCTGACATGTGG - Intergenic
979543744 4:121916397-121916419 TTCTCACCACCTCTGTCTGTGGG - Intronic
980738629 4:136922073-136922095 TTCTGACCATCTCTGAATAGTGG - Intergenic
980859910 4:138486602-138486624 CTCTGCCCTCCTCTGAATGGTGG - Intergenic
982189992 4:152843905-152843927 TTGTGCCCTCCCCTGACTTGTGG + Intronic
986180975 5:5392692-5392714 TTCTGACCTACTGAGAGTGGAGG + Intergenic
986707177 5:10461835-10461857 GTCTGTCTTCCTCTGACTGTTGG - Intronic
987114890 5:14718348-14718370 TTTTGACCTCCTCACATTGGAGG - Intronic
989437595 5:41433089-41433111 TTCTGAGCTCCTCTGCCATGTGG - Intronic
989677975 5:43994636-43994658 TTCTGTCTTTCTCTGGCTGGAGG + Intergenic
991486677 5:67144246-67144268 TTCTTCCCACCCCTGACTGGTGG + Intronic
992004131 5:72461181-72461203 TTTTGTTCTCCTCTGAGTGGAGG + Exonic
996163641 5:120197727-120197749 TTCTGGCTTCTTCTGACTGAGGG - Intergenic
996431534 5:123384794-123384816 TTCTGATCTTCTCTGACCTGTGG - Intronic
996731116 5:126718389-126718411 AGCTGACCTCCACTGACAGGAGG - Intergenic
997021564 5:130008276-130008298 CTCTGACCTGCTATCACTGGAGG - Intronic
997460814 5:134051086-134051108 CTCTGTCCTCCTCTAGCTGGAGG - Intergenic
999880260 5:155855171-155855193 TTCTGACCTGCTCTGAATGTGGG - Intergenic
1003752220 6:9071883-9071905 TTCTTACCTCCTATGAATGCTGG - Intergenic
1006861596 6:37175064-37175086 TCCTTTCCTCCTCTGACTTGGGG + Exonic
1007429542 6:41768771-41768793 ATCCTACCTCCTCTGAGTGGGGG - Intergenic
1010845094 6:80696807-80696829 TTCTGCCCTTCTCTCAGTGGAGG - Intergenic
1015162326 6:130167305-130167327 TTCTCCCCACCTCTGACTGTAGG - Intronic
1015255638 6:131176807-131176829 TTCTGACCACCACAGGCTGGTGG + Intronic
1023613603 7:41995954-41995976 GTCTGACCTCTGCTAACTGGTGG + Intronic
1024126214 7:46298349-46298371 TTCTTTCCTCCTCTTACTGTTGG - Intergenic
1025266853 7:57468749-57468771 TTATGCCCTGCTCTGACTGAAGG - Exonic
1026180265 7:68033260-68033282 TACTGACCCCCTCTGACAGAAGG - Intergenic
1027200180 7:76059293-76059315 TTCAGACCTCAACTGACTGCTGG + Intronic
1033756213 7:144399750-144399772 TTCTGACCTGCATTGACTGCTGG + Exonic
1035306285 7:157934799-157934821 TGCGGACCTCTTCTGACTGATGG - Intronic
1035810685 8:2488664-2488686 ATCTGACCTACTTTGACTGAAGG + Intergenic
1036416616 8:8555272-8555294 TGCTGTGCTCCTCTGAGTGGTGG - Intergenic
1037311877 8:17564664-17564686 TGCTGCCCTGCTCTGACAGGAGG + Intronic
1038819165 8:30936612-30936634 TTCTAACCTCCTCTCACTCCTGG + Intergenic
1039809595 8:41034548-41034570 TTCTGTTCTCCTCTTACTGCAGG + Intergenic
1040889083 8:52296534-52296556 TTCTGACCGTCACTTACTGGTGG + Intronic
1041411587 8:57561842-57561864 TGCTGCCCTCCACTGCCTGGGGG - Intergenic
1042739482 8:72027373-72027395 TCTTTACCTCCTCTAACTGGTGG + Intronic
1043258936 8:78173124-78173146 TTCTGAAATCCACTGACTGGTGG + Intergenic
1045057525 8:98382428-98382450 CTCTGACCTCCTCTGCCTTCTGG - Intergenic
1045472603 8:102525735-102525757 CTCTGGCCTTCTCTGACTTGTGG - Intergenic
1052336858 9:27329249-27329271 TTCTGACCACCTGTGACGAGGGG - Exonic
1055409571 9:76014674-76014696 TTCTGACTTCTTCTGCCAGGAGG + Intronic
1056802430 9:89701786-89701808 TACTGGCCTCCACTGCCTGGGGG - Intergenic
1057208766 9:93188223-93188245 TTCTGCCCTCCACAGGCTGGGGG + Intronic
1059905830 9:118984784-118984806 TTCTGAGGCCCTCTGAATGGTGG + Intergenic
1060987695 9:127829033-127829055 CCCTGACCTCCTCTCTCTGGTGG + Intronic
1061114441 9:128600393-128600415 TTTGGACCGCCTCTTACTGGTGG - Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1062118811 9:134822976-134822998 TTCTGCCCTCCTCTCTCTGCAGG + Exonic
1185619550 X:1445103-1445125 ATCTGCCCTCCTCTGACTTTTGG + Intronic
1188079974 X:25826984-25827006 TGCTTTCCTTCTCTGACTGGTGG - Intergenic
1195942176 X:110175651-110175673 TTCTTCCTTCCTCTGACAGGTGG - Exonic
1198023492 X:132682197-132682219 TTCAGACCCCCTCTCAATGGAGG + Intronic
1198084485 X:133269244-133269266 TTGGGAGCTCCTCTGATTGGAGG + Intergenic
1199991882 X:152992037-152992059 TCCTGCCCTCTTCTGCCTGGAGG - Exonic