ID: 1133981684

View in Genome Browser
Species Human (GRCh38)
Location 16:10637385-10637407
Sequence CAGTGAATAAAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 8, 3: 78, 4: 863}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133981681_1133981684 -5 Left 1133981681 16:10637367-10637389 CCCTCTTAATAACTAGATCAGTG 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG 0: 1
1: 0
2: 8
3: 78
4: 863
1133981680_1133981684 5 Left 1133981680 16:10637357-10637379 CCAGAGTTTACCCTCTTAATAAC 0: 1
1: 0
2: 3
3: 17
4: 229
Right 1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG 0: 1
1: 0
2: 8
3: 78
4: 863
1133981678_1133981684 28 Left 1133981678 16:10637334-10637356 CCCGCTTTAAAAAAAAAAAAAAT 0: 3
1: 91
2: 1432
3: 15288
4: 157401
Right 1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG 0: 1
1: 0
2: 8
3: 78
4: 863
1133981679_1133981684 27 Left 1133981679 16:10637335-10637357 CCGCTTTAAAAAAAAAAAAAATC 0: 5
1: 39
2: 540
3: 4452
4: 33277
Right 1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG 0: 1
1: 0
2: 8
3: 78
4: 863
1133981682_1133981684 -6 Left 1133981682 16:10637368-10637390 CCTCTTAATAACTAGATCAGTGA 0: 1
1: 0
2: 2
3: 3
4: 136
Right 1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG 0: 1
1: 0
2: 8
3: 78
4: 863

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133981684 Original CRISPR CAGTGAATAAAGAAGGAAGA AGG Intronic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
902276509 1:15343810-15343832 CAGAGAAGAAAAAAGGAAGTCGG - Intronic
904268574 1:29332801-29332823 AAGTGAATAATGAAGGAAATAGG - Intergenic
904833967 1:33323145-33323167 CCTTGAATAAAGAAGGAGAAAGG - Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905899831 1:41574166-41574188 CTCTGAAGCAAGAAGGAAGAGGG + Intronic
906036960 1:42756699-42756721 GAATGAATAAAGATGGAAGTGGG - Intronic
906189681 1:43889178-43889200 TAGTGAATAAAGAAGGGAACAGG + Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907592428 1:55688000-55688022 AAATGAATAAAAAAGAAAGAAGG + Intergenic
907697819 1:56751698-56751720 GAGTGAAGAAAGAAGTGAGAAGG - Intronic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908162654 1:61426283-61426305 CAGTCAAAAAAGGGGGAAGAGGG - Intronic
908641029 1:66223711-66223733 CAGTGCATAGAGAAAGAGGAGGG + Intronic
909263662 1:73527760-73527782 CAGGGACTAAAGAAAGATGATGG + Intergenic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
909621024 1:77667482-77667504 TAGTCAATAAAGAAGAAAGAAGG - Intronic
910281226 1:85503745-85503767 AAGAAAATAAAGCAGGAAGATGG + Intronic
910774159 1:90858299-90858321 CATTGAATAAAGGAGCAAAAAGG + Intergenic
910921828 1:92356734-92356756 TAGAGAATAAAAAAGGAAAATGG - Intronic
911090619 1:94014298-94014320 CAATGAAAAAGGAAGGAAGGAGG + Intronic
911304260 1:96213987-96214009 GAGTGTGTAAAGAAGGAAGGTGG + Intergenic
911466599 1:98262207-98262229 GAGTGAATTTAGAAGGACGATGG + Intergenic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911721088 1:101192003-101192025 CATTGAATCATGATGGAAGAAGG + Intergenic
911824166 1:102460628-102460650 CAGTCAGTAAAGACTGAAGAAGG - Intergenic
912233864 1:107827291-107827313 TGGAGAATAAGGAAGGAAGAGGG - Intronic
912253333 1:108033270-108033292 CACTGAAGAAAGGAGGAATAAGG - Intergenic
912974117 1:114312456-114312478 CAGTAAATAAAGCAGGAATCAGG - Intergenic
913646908 1:120865721-120865743 CTATTAACAAAGAAGGAAGAGGG + Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
913955467 1:143286561-143286583 CAGTCAAGAAAGAAGCAAGAGGG - Intergenic
913981964 1:143528884-143528906 CAGTCAAGAAAGAAGCAAGAGGG + Intergenic
914076331 1:144355545-144355567 CAGTCAAGAAAGAAGCAAGAGGG + Intergenic
914079740 1:144397142-144397164 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914102847 1:144610952-144610974 CAGTCAAGAAAGAAGCAAGAGGG - Intergenic
914174641 1:145265680-145265702 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914529368 1:148507168-148507190 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914802477 1:150971709-150971731 AATTGAATAAAGAAGGGACAAGG + Intronic
915153656 1:153856229-153856251 CAGAGAATTAAGATGGCAGATGG - Intronic
915594203 1:156887253-156887275 GAGGGAAGAAAGAAGGGAGAGGG - Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916259731 1:162829527-162829549 GAGGTAAGAAAGAAGGAAGAAGG - Intronic
916260727 1:162839683-162839705 CAGGGAATAAAGAAAGAAAGAGG + Intronic
916320054 1:163494289-163494311 CAGAGAATTACAAAGGAAGAGGG + Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916736720 1:167614129-167614151 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
917713893 1:177714220-177714242 CATTTCATAAAGAAGGAAGTTGG + Intergenic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
918273362 1:182925099-182925121 AAGTGAAGAAAGAAAGAAGGAGG + Intronic
918482918 1:184998727-184998749 GAAGGAAGAAAGAAGGAAGAAGG + Intergenic
918761869 1:188420602-188420624 GAGTGAGGAAGGAAGGAAGAAGG - Intergenic
918922947 1:190738551-190738573 AAGAGATTCAAGAAGGAAGAGGG - Intergenic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
920042874 1:203114562-203114584 AAGTGAATAAAACAGAAAGAGGG - Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920866610 1:209758709-209758731 CAGGGACTGATGAAGGAAGAGGG - Exonic
921359783 1:214320040-214320062 CAGAAAAGAAAGAAGGAAGGAGG + Intronic
921762049 1:218926280-218926302 CACTGAATAGAGAGGGAAGGGGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
921941444 1:220844104-220844126 TAGTGAAGAAAGAAAGAAAAGGG + Intergenic
922456396 1:225777128-225777150 AAGTAAATAAATAAAGAAGATGG - Intergenic
922567165 1:226608235-226608257 CAGGGAGGAAAGAAGGGAGAGGG + Exonic
922954847 1:229590512-229590534 CAATGAATAAAGATGAAATAGGG - Intergenic
923225354 1:231934104-231934126 CAATGAAGAAAGTGGGAAGAGGG + Intronic
923295000 1:232585653-232585675 AAGAGAACAAAGGAGGAAGAAGG + Intergenic
923477654 1:234350207-234350229 CAAAGAAGAAAGAAGAAAGAAGG + Intergenic
923484424 1:234415432-234415454 CTTTGAATAAAGGAGGAAAAGGG + Intronic
924202593 1:241675140-241675162 TAGGGAAGAAGGAAGGAAGAAGG - Intronic
924696279 1:246403478-246403500 CAGGGAGTAAAGAAGGAAACTGG - Intronic
924802889 1:247340469-247340491 CAGCTAATAGAGGAGGAAGAAGG - Intergenic
1062900266 10:1138809-1138831 AAGTGAAAAAAGAATGAAAAAGG + Intergenic
1063297287 10:4819648-4819670 AAATGAAGAAAGAGGGAAGAAGG + Intronic
1063829152 10:9932286-9932308 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1064371709 10:14757850-14757872 AAGAGAATAAAGAAGAAAAATGG - Intronic
1064759716 10:18605373-18605395 AAGTAAATAAAAAGGGAAGAAGG + Intronic
1064851418 10:19713119-19713141 TAGGCAAGAAAGAAGGAAGAAGG - Intronic
1064976328 10:21120623-21120645 CAATAAATATAGAAGGATGATGG - Intronic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065770517 10:29074055-29074077 GAGGGAAGAATGAAGGAAGAAGG + Intergenic
1065788996 10:29242552-29242574 CAGTGAATACAAGAGGAAGCGGG + Intergenic
1065904800 10:30240757-30240779 AAAAGAAGAAAGAAGGAAGAAGG + Intergenic
1066017663 10:31264210-31264232 CAGTCAATCCACAAGGAAGAGGG - Intergenic
1066462178 10:35621714-35621736 CAGTGAATGAATTAGGAACATGG - Intergenic
1067202479 10:44185346-44185368 AATTGAGAAAAGAAGGAAGAAGG + Intergenic
1067256906 10:44650201-44650223 TAAGGAATAAGGAAGGAAGAAGG - Intergenic
1067514924 10:46931020-46931042 TAGTGAAGAAACCAGGAAGATGG + Intronic
1067647330 10:48120794-48120816 TAGTGAAGAAACCAGGAAGATGG - Intergenic
1067799954 10:49352086-49352108 CAGTCAATAATAAAAGAAGAGGG + Intergenic
1068199656 10:53766575-53766597 CAGGGAAAAAAGAAGTAATATGG + Intergenic
1068282431 10:54891966-54891988 CAAAGAATAAAGGAGGCAGAGGG + Intronic
1068537265 10:58254212-58254234 AAAAGAATAAAGAATGAAGAGGG - Intronic
1068593510 10:58875475-58875497 CAAAGAATAAAGTAGGAAAAGGG + Intergenic
1068687590 10:59885214-59885236 TATTGAAAAAAGAATGAAGATGG - Intronic
1068862051 10:61857240-61857262 CTGTTAATAAAGAAAGAAGCAGG - Intergenic
1069107145 10:64397191-64397213 AAGTAAAGAAAGAAAGAAGAGGG + Intergenic
1070282837 10:75062371-75062393 CAGTGATCAAAGGAGGCAGACGG - Intergenic
1070292929 10:75132992-75133014 CAATCAATAAAGAAAGAAAAAGG + Intronic
1070323830 10:75374656-75374678 CAGTGAATAAAGAAACCACACGG - Intergenic
1070544423 10:77441432-77441454 GACTGACCAAAGAAGGAAGAAGG + Intronic
1070699577 10:78591288-78591310 CAGTGAACAAAGAAGGAAACAGG + Intergenic
1071219227 10:83444319-83444341 CACAGAATAAAGAAAGAAAAAGG - Intergenic
1071687168 10:87771044-87771066 AAGTGTATAAAGAAGACAGAAGG + Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1073908091 10:108307865-108307887 CAGAAAAGAAAAAAGGAAGATGG + Intergenic
1074075397 10:110119067-110119089 AAGTGAATAAAGTGGGAAGTGGG + Intronic
1074615892 10:115067866-115067888 CAGAAAAGAAGGAAGGAAGAAGG + Intergenic
1074786255 10:116844169-116844191 CAGTTAATAAATAGGGGAGATGG - Intergenic
1074797906 10:116967573-116967595 AAGTAAATAAAGAGGGCAGAAGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1074930475 10:118120282-118120304 CAGAGAATAAAGAAGAGACAGGG - Intergenic
1075852040 10:125597168-125597190 CAGTGGATAGAGAAGACAGATGG - Intronic
1076870878 10:133193528-133193550 AAATAAATAAAGGAGGAAGAAGG + Intronic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077605510 11:3608475-3608497 CAATAAATAAAAAAGGAAAAAGG + Intergenic
1077652937 11:3990815-3990837 CCGTGAATATAAAATGAAGATGG - Intronic
1077816248 11:5688462-5688484 CATTGATTAAAGTATGAAGATGG + Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1078281631 11:9908319-9908341 TTGTGAATAGAGAAGGCAGATGG + Intronic
1078500370 11:11868296-11868318 CAGGGATTAAAGAGGGAATAGGG - Intronic
1078907342 11:15699885-15699907 GAATGAATGAAGGAGGAAGAAGG - Intergenic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079774835 11:24512023-24512045 GAGTGAATAAAGAAAGTTGAAGG + Intronic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080295297 11:30720326-30720348 AAGAGAAAGAAGAAGGAAGAAGG - Intergenic
1080603891 11:33847822-33847844 CAGTGATTAAAGAGAAAAGATGG - Intergenic
1080680766 11:34473675-34473697 GAGAGAAGAAAAAAGGAAGAAGG - Intergenic
1080975048 11:37329375-37329397 CACTGAATAATGAAGTTAGATGG - Intergenic
1081239934 11:40692720-40692742 CAATCAACAAAGAAGGAAAAAGG - Intronic
1081367435 11:42253128-42253150 CACTGTTTAAAGAAGGAAGAAGG + Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1082869186 11:57928256-57928278 CTGGGAATAAAGAAGGAATAAGG + Intergenic
1083325483 11:61870946-61870968 CAGACAATAAAAAAGGAACACGG + Intergenic
1083837323 11:65279693-65279715 AAGTGAAAAAGGAAGCAAGAAGG - Intronic
1084551392 11:69845107-69845129 CTGTTACTAAAGAAGGAAGGGGG - Intergenic
1085065497 11:73491828-73491850 GAGTGAACAAAGGAGGTAGATGG - Intronic
1085136835 11:74098079-74098101 CAAAGATTAAAGAATGAAGAAGG - Exonic
1085237269 11:75024859-75024881 CACTGAAAAATGAAAGAAGATGG + Intergenic
1085992946 11:81873218-81873240 AAGTCAATAAAGGAAGAAGAGGG + Intergenic
1086157406 11:83682734-83682756 CAGTGACTAAAGAAGGTATCAGG + Intronic
1086185839 11:84014690-84014712 CAGCTAATAAATCAGGAAGAGGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086513662 11:87588128-87588150 CAGTGATTAAAAGAGGAAAATGG + Intergenic
1086560580 11:88163940-88163962 CAGTGGATAAAGCAGGGGGAAGG + Intronic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088028946 11:105222597-105222619 CAGTAAATAAGGAAGAAAAATGG + Intergenic
1088510795 11:110572591-110572613 CAATGAATGAAGAAAGAATAAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088639442 11:111857127-111857149 AAATAAAGAAAGAAGGAAGACGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089640278 11:119843340-119843362 GAGTAAATAAAGAAGGGTGAGGG - Intergenic
1091447358 12:551659-551681 CAGTGAAGTAAATAGGAAGAGGG + Intronic
1091928255 12:4373221-4373243 CAATAAGTAGAGAAGGAAGAGGG - Intronic
1092027704 12:5256851-5256873 AAGTGGACAATGAAGGAAGAAGG + Intergenic
1092292525 12:7170656-7170678 CATTAAATAAGGAAGGGAGAAGG - Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092582545 12:9860166-9860188 CAATGAATAAAAAAGGCATAAGG + Intronic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1093019981 12:14194316-14194338 GAGTGAAGGAAGAAGGAAGGAGG - Intergenic
1093201107 12:16187173-16187195 AACTGAATAAAGAAGAAATAAGG + Intergenic
1093328957 12:17812307-17812329 CAGTGAATAAAGTAGAAACCAGG - Intergenic
1093568895 12:20643034-20643056 AAGTGTATCAAGACGGAAGAGGG + Intronic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093947299 12:25124337-25124359 GAATGAATAAATAAGGGAGAAGG - Intronic
1094063408 12:26339325-26339347 CACTGAATAAAGAACTGAGATGG - Exonic
1094092508 12:26666540-26666562 CAGTAAAAAAAGAAAGAAAAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094727325 12:33133686-33133708 CAGGCAAGAAGGAAGGAAGAAGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1095337683 12:41048357-41048379 CATTGACTAAAGAGAGAAGATGG - Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096028420 12:48388581-48388603 GAGAGAATAAAAAATGAAGAAGG - Intergenic
1096280958 12:50253137-50253159 CAGTAAATATAGAAAGAAGAGGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097625425 12:61994294-61994316 CAGTGTATCAAGAGAGAAGAAGG - Intronic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1097901562 12:64878690-64878712 GGGTGAAGGAAGAAGGAAGAAGG - Intronic
1098211640 12:68172392-68172414 CAGAGAAGAAACATGGAAGATGG - Intergenic
1098947080 12:76601018-76601040 GAGCGAATATACAAGGAAGAAGG - Intergenic
1099185206 12:79508780-79508802 AAGCGAATAGAGCAGGAAGATGG + Intergenic
1099289061 12:80752522-80752544 CAGGAAATAAAGAAGAAAGTGGG + Intergenic
1099480738 12:83162789-83162811 AATTGAAGAATGAAGGAAGAAGG - Intergenic
1099666178 12:85632160-85632182 CTTTGCATAAAAAAGGAAGAAGG - Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100682125 12:96936378-96936400 AAGTGAATAGAAAAGTAAGATGG + Intronic
1101086375 12:101240494-101240516 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101694567 12:107112913-107112935 GAGGGAATGAAGAAGGCAGAGGG + Intergenic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102868093 12:116390118-116390140 AACTGAATAGAGAATGAAGAAGG - Intergenic
1102899319 12:116624071-116624093 AGGTGAAGGAAGAAGGAAGAAGG + Intergenic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1102990445 12:117311890-117311912 CATGGAATGAAGAAGGGAGAGGG - Intronic
1103030239 12:117606724-117606746 GAGTAAGGAAAGAAGGAAGAAGG - Intronic
1103246677 12:119464021-119464043 GAGGGAAGAAAAAAGGAAGAAGG - Intronic
1103246726 12:119464336-119464358 GAGGGAAGAAAAAAGGAAGAAGG - Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103776712 12:123371693-123371715 GACTGAAGAAAGAAGGGAGAGGG - Intergenic
1104870253 12:131990005-131990027 CCGTGAAGAAAGGGGGAAGAAGG + Exonic
1105986660 13:25573807-25573829 AAGTGAATAAAGATTGATGAAGG + Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106371419 13:29137602-29137624 GAAAGAAGAAAGAAGGAAGAAGG - Intronic
1106962039 13:35010285-35010307 GACTCAATAAAGAAGGTAGATGG + Intronic
1107167869 13:37303952-37303974 CAGTGGAAAATGAAGAAAGAAGG - Intergenic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1108075838 13:46678946-46678968 CTCTGAATAAATAAGGAAGGAGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108543652 13:51468738-51468760 AAGTAAAGAAAGAAGGAACAAGG - Intergenic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1108836989 13:54562769-54562791 CAGTGAATAAACATACAAGATGG - Intergenic
1109620880 13:64903044-64903066 CAGTAAAAAAAGAATAAAGAAGG + Intergenic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111466341 13:88616375-88616397 CAGTGTATTAAGAAAGATGATGG + Intergenic
1111994539 13:95151505-95151527 CAAAGAGGAAAGAAGGAAGAAGG + Intronic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1112709448 13:102110775-102110797 CAGCGAATAAATGAAGAAGATGG - Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1113007701 13:105725922-105725944 CCGTGAAGAAGGAAGGAAGTCGG - Intergenic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1114498840 14:23153380-23153402 CTGTGTATAATGAAGGAAGGCGG - Intronic
1115620118 14:35132837-35132859 AAGGGAAGGAAGAAGGAAGAAGG + Intronic
1115927917 14:38457614-38457636 CAGGCATTAAAGAAGGAAGTAGG + Intergenic
1116018511 14:39433503-39433525 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1116124385 14:40764028-40764050 AAGCAAATAAAGGAGGAAGAAGG - Intergenic
1116241491 14:42348765-42348787 AAGTGAACAAAGAAGGGTGAAGG + Intergenic
1116332507 14:43613768-43613790 CAGTTAATAAAGGAGCAAGGAGG + Intergenic
1116405546 14:44561209-44561231 AAGTGAATAAAGTGGGAAAAGGG - Intergenic
1116631733 14:47344107-47344129 CCAAGAATAAAGAAGGCAGAAGG - Intronic
1116674405 14:47887205-47887227 CACTGAGTAAAAAAGCAAGATGG + Intergenic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118117051 14:62790576-62790598 CAGTGAAAAAAAAAAAAAGAAGG - Intronic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118630490 14:67698005-67698027 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119600654 14:75974139-75974161 CAGAAAAAAAAGAAGGGAGATGG + Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120222344 14:81748565-81748587 CAGTGAAGAAGAGAGGAAGAAGG + Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120380738 14:83775852-83775874 GGGTGAATAGACAAGGAAGAAGG + Intergenic
1120400401 14:84023508-84023530 CAGTTCATAAAGTAGGAAGCAGG - Intergenic
1120535829 14:85693395-85693417 ACGTGAATAACTAAGGAAGAAGG - Intergenic
1121169229 14:91839123-91839145 CATTAAATAAAGAATGAATAGGG - Intronic
1121575343 14:94980428-94980450 AAGAAAATAAAGCAGGAAGAGGG - Intergenic
1121624595 14:95374916-95374938 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624618 14:95374985-95375007 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624626 14:95375019-95375041 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624649 14:95375088-95375110 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624656 14:95375122-95375144 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624678 14:95375202-95375224 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121624688 14:95375237-95375259 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624704 14:95375292-95375314 GAGGGAGGAAAGAAGGAAGAGGG - Intergenic
1121624716 14:95375327-95375349 GAGAGAGGAAAGAAGGAAGAGGG - Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121952168 14:98181022-98181044 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1123788267 15:23693929-23693951 CAGTGAATAAACTAGTGAGAAGG - Intergenic
1123889732 15:24764517-24764539 CGGTGAATAAAGACGGACCAAGG - Intergenic
1124659431 15:31533896-31533918 TAGAGAATAAAGAAGCAAAAAGG + Intronic
1124829267 15:33132179-33132201 CAGCCAGGAAAGAAGGAAGAGGG - Intronic
1124957747 15:34370816-34370838 AGGAGAAGAAAGAAGGAAGAAGG - Intergenic
1125076924 15:35630315-35630337 AAGTAAAAAAAGAAGGAGGATGG + Intergenic
1125175131 15:36812297-36812319 CAAAGATTAAATAAGGAAGATGG + Intergenic
1125342177 15:38685859-38685881 CAATGAAGAAAATAGGAAGAGGG - Intergenic
1125724249 15:41860358-41860380 AACTGAATGAAGAAGGAAGTGGG + Intronic
1126196394 15:45936601-45936623 CACTGAATACTGAAGAAAGAAGG + Intergenic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1126787992 15:52194397-52194419 CCATGAATGAAGAAGAAAGATGG - Intronic
1126840801 15:52715582-52715604 CTGTGACGAAAGAAGGAAAAGGG + Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127290905 15:57570310-57570332 CAGAGAATATGGAAGGGAGAAGG + Intergenic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1130035754 15:80359977-80359999 CAATAAACAAAGAAGGAAGCAGG + Intronic
1131044540 15:89303033-89303055 AAGGGAATAAAGAAGGTTGAAGG - Intronic
1131071291 15:89467783-89467805 CAGTTAATAAAGGAGCAAGTGGG + Intergenic
1131081751 15:89542461-89542483 CAGAGAAAAACGAAAGAAGAAGG - Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131531259 15:93194395-93194417 AACAGCATAAAGAAGGAAGAAGG - Intergenic
1132241786 15:100263374-100263396 GAGGGAATAAAGAAGGAATGTGG - Intronic
1133158099 16:3889942-3889964 CAGACAGGAAAGAAGGAAGAAGG - Intergenic
1133422117 16:5654775-5654797 GAGAGAGGAAAGAAGGAAGAAGG - Intergenic
1133430586 16:5733710-5733732 AAGGGAATAAAGAGGTAAGAGGG - Intergenic
1133463566 16:6008242-6008264 GAGTGAATAAAGAGACAAGAGGG + Intergenic
1133580719 16:7142014-7142036 AAAAGAAGAAAGAAGGAAGAAGG - Intronic
1133663059 16:7937530-7937552 CAGTAAGTAAGGAAGGAAGTGGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136098405 16:27975241-27975263 CAGGGAATCAAGAGGGCAGAAGG - Intronic
1136155661 16:28380380-28380402 CTGGGAAGAAAGAAGGCAGAGGG + Intronic
1136207423 16:28734909-28734931 CTGGGAAGAAAGAAGGCAGAGGG - Intronic
1136427134 16:30176382-30176404 AAGTTAAAAAAGAAGAAAGAAGG + Intergenic
1136701313 16:32146234-32146256 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136766349 16:32781230-32781252 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1136801749 16:33089148-33089170 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136938466 16:34498866-34498888 AAGTGAGAAAAGAAGGAAGGAGG - Intergenic
1136961353 16:34849691-34849713 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1137723977 16:50644838-50644860 CAGTGAAGAAAGGAGGGAGGAGG - Intergenic
1137924080 16:52523024-52523046 CAATGAATAAATAAGGCAGAGGG + Intronic
1138216666 16:55210714-55210736 AGGTGAATACAGAAGGAATAAGG + Intergenic
1138466106 16:57191963-57191985 CAGTGAGGAAAGACGGAAAAAGG - Intronic
1138653723 16:58477579-58477601 AATTGAATAAAGGAGGAAAAAGG + Intronic
1138970753 16:62140390-62140412 CATTGAATAAACAAAGAATAAGG + Intergenic
1139085073 16:63574604-63574626 AAGTGACTCATGAAGGAAGAGGG + Intergenic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1140163233 16:72521446-72521468 CTATAAATAAAGAAGGAAGCAGG + Intergenic
1140215955 16:73008813-73008835 CTGTGACTAAAGAAGGCAGGAGG + Intronic
1140558595 16:75950092-75950114 CAGTTTATAAAGTATGAAGATGG + Intergenic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1140857477 16:78990687-78990709 CATAGAGGAAAGAAGGAAGAAGG + Intronic
1140982030 16:80119663-80119685 TATGGAATAGAGAAGGAAGAAGG - Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141902309 16:86999503-86999525 GAATGAACGAAGAAGGAAGAAGG - Intergenic
1142441662 16:90102383-90102405 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1203068737 16_KI270728v1_random:1043476-1043498 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1142632314 17:1233066-1233088 GAATAAACAAAGAAGGAAGAGGG - Intergenic
1142887291 17:2920635-2920657 CAGGGATTAAAGGAGGAAGCAGG + Intronic
1143437316 17:6938966-6938988 CAGTTAATAAAGGAGCAAGGGGG - Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1145299643 17:21623900-21623922 TAGAGAGTAAAGAAGGACGAAGG + Intergenic
1145350640 17:22079367-22079389 CAGAGAGTAAAGAAGGACGAAGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145763284 17:27440334-27440356 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1145931779 17:28691172-28691194 AAGTACACAAAGAAGGAAGACGG + Intronic
1146112174 17:30099927-30099949 GAGTGAATACAGAAAAAAGAGGG - Intronic
1146266292 17:31455219-31455241 AAGTAACTAAACAAGGAAGAGGG + Intronic
1147133655 17:38423016-38423038 CAGTGACTAGGGGAGGAAGAAGG - Intergenic
1147161294 17:38570847-38570869 CAAAGGATAAAGATGGAAGAGGG + Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1148013220 17:44502864-44502886 CAGTGAAGAAAGAAAAGAGAAGG + Intronic
1148372684 17:47112678-47112700 CAATAAATAAAGAAGAAATAAGG + Intergenic
1148474854 17:47921550-47921572 CAGTGAATAAAACAGGAATCTGG - Intronic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1150600281 17:66645360-66645382 CTGTGAATCAAGAAAGGAGAGGG - Intronic
1151315596 17:73320147-73320169 CAGTAAAAAGAGAAGGAAGGAGG - Intergenic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1151734148 17:75928333-75928355 CAGTGAGTGAAGAAAGAAAATGG + Intronic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152844186 17:82589537-82589559 CAGTGAATACAGAACGAATCAGG - Intronic
1153082222 18:1241022-1241044 CAACAAACAAAGAAGGAAGAAGG + Intergenic
1153160641 18:2200956-2200978 GAGTTAATACAGAAGGGAGAAGG + Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153896356 18:9565566-9565588 CAGTGAACACACAAAGAAGAAGG + Intronic
1154943654 18:21138463-21138485 GACTGAAGAAAGAAAGAAGAGGG + Intergenic
1157544010 18:48535262-48535284 CAGTGCAGAAGGAAGGAAGTTGG - Intergenic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1158066525 18:53416712-53416734 TAGTAAATAAATAAGGAAAAGGG - Intronic
1158438599 18:57452910-57452932 CAATGAATAAAGAAGCAAGTTGG + Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1158701179 18:59748653-59748675 GAGGGAGTAAAGAAGGAAAAAGG - Intergenic
1158776250 18:60583579-60583601 GAGTGAAAAAGGAAGGATGACGG - Intergenic
1159097203 18:63917500-63917522 AAGTGAAAAAAAAAGGAAAATGG + Exonic
1159351214 18:67275573-67275595 CAGCAAATAAAGAATGAAAAAGG - Intergenic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1159648704 18:70952109-70952131 AAGTGAATAGGAAAGGAAGAAGG + Intergenic
1159817295 18:73091164-73091186 CAGAGAATAAAGAAGAAAAAAGG - Intergenic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161157175 19:2738575-2738597 CAGAGAAGCAAGAAAGAAGAAGG - Intronic
1162481600 19:10929849-10929871 CAGCTAATAAAGAACAAAGACGG - Exonic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1162934393 19:13974187-13974209 CAGTGAGTGAAGCAGGAAGGGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164741169 19:30576478-30576500 AAGTCAATAAAGAAGACAGAGGG - Intronic
1164771941 19:30816247-30816269 AAGGGAAGAAAGAAGGAAGGAGG - Intergenic
1166043495 19:40216631-40216653 GAGCCAATGAAGAAGGAAGAGGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1166429278 19:42710411-42710433 CTGAGAAGAAAGTAGGAAGAAGG - Intronic
1167480602 19:49728375-49728397 CAGGGAATAAAGTAGGAATTTGG + Intergenic
1167485882 19:49762788-49762810 TAGTGAATGAAGAAGAAAGTAGG - Intronic
1167556103 19:50196709-50196731 CAATGAATAAATAAATAAGATGG - Intronic
1167598644 19:50440803-50440825 CAATGAGTGAAGAAGGCAGAGGG + Intronic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
924969859 2:115954-115976 AAGTGACTAAATAAAGAAGATGG + Intergenic
924989071 2:295666-295688 CATGGAAGAAAGAGGGAAGAAGG + Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925774698 2:7323340-7323362 CAGTGTTTGAAAAAGGAAGAAGG - Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926244580 2:11113515-11113537 GAGGGAAGGAAGAAGGAAGAAGG - Intergenic
926244660 2:11113776-11113798 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
926455927 2:13068848-13068870 TCGTAAATAAAGAAGGAAAACGG + Intergenic
926456091 2:13070128-13070150 CAGTAAATAAGGAAGGGAGGGGG - Intergenic
926898405 2:17721553-17721575 TAGGGAATAAAGAGGGAAAATGG - Intronic
927233877 2:20852053-20852075 AATTGAAGAAAGAAAGAAGAGGG - Intergenic
927617258 2:24611675-24611697 CAGTAAAAAAAGAACAAAGAAGG - Intronic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928670771 2:33600881-33600903 TAGTCAAAAAAGAAGGAATATGG - Intergenic
928935770 2:36676415-36676437 TAATGAATAAAGATTGAAGATGG - Intergenic
929092081 2:38228881-38228903 GAAAGAAGAAAGAAGGAAGAAGG + Intergenic
929173762 2:38957509-38957531 CAGTGAACAAATAAATAAGATGG + Intronic
929754348 2:44751683-44751705 CAGTAAAGAGATAAGGAAGAAGG - Intronic
929827630 2:45321728-45321750 CAGTGAGAAAAGCAGCAAGACGG + Intergenic
930408486 2:50993462-50993484 CAGTGACTAAAGAAGGGAAAGGG - Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
931090459 2:58880549-58880571 CAGGGAAGGAGGAAGGAAGAAGG + Intergenic
931099844 2:58984857-58984879 CAGTGAAAAAAAACTGAAGATGG - Intergenic
931105878 2:59055058-59055080 AAATGAAGGAAGAAGGAAGAAGG - Intergenic
931481203 2:62642617-62642639 CAGTAAATAAAAAAGGATAAGGG + Intergenic
932410492 2:71544197-71544219 GAGTGAATAAAGCAGGGAGAGGG - Intronic
932611271 2:73202302-73202324 CAGTGAGCAAAGGAGAAAGACGG + Exonic
932751039 2:74371864-74371886 CAGTGAGAAAAGAAGAATGAAGG + Intronic
933171221 2:79128113-79128135 CAGTAAATAAAGAAAGAATCAGG + Intergenic
933273619 2:80260290-80260312 CAGTGAAGAAAGATGGCAGAGGG + Intronic
933656515 2:84891666-84891688 CTGGCAAGAAAGAAGGAAGAAGG - Intronic
934160435 2:89244497-89244519 CTGTGAGTAAACAAGCAAGATGG - Intergenic
934206842 2:89937941-89937963 CTGTGAGTAAACAAGCAAGATGG + Intergenic
934649694 2:96083812-96083834 CAGGCACTAAGGAAGGAAGAGGG - Intergenic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
934907920 2:98221937-98221959 AAGTGAAAAAAGAAGCAAGCTGG + Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
935654842 2:105413247-105413269 GAGTGAAGAAATAGGGAAGAGGG - Intronic
935876211 2:107510981-107511003 CACTCAAGAAAGAAGAAAGAAGG - Intergenic
936616928 2:114057332-114057354 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
936720387 2:115245220-115245242 CAATGAATAGATAAAGAAGATGG - Intronic
936720664 2:115248629-115248651 CATTGAATAAGGGAGGGAGATGG + Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936962458 2:118089529-118089551 CACTGAATGAAGATGGATGAAGG + Intronic
937174249 2:119911132-119911154 TAGACAATAAAGAAGGAACATGG + Intronic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937542023 2:122967677-122967699 CAGTGAAATACAAAGGAAGACGG - Intergenic
937615835 2:123921358-123921380 AAGGAAAGAAAGAAGGAAGAAGG + Intergenic
938173791 2:129105700-129105722 GAAGGAAGAAAGAAGGAAGAAGG + Intergenic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939325694 2:140685139-140685161 CTGTGAATGAAGAAAGTAGAGGG - Intronic
939888745 2:147710281-147710303 CAGTGAAGAAAGACTGGAGACGG + Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940250548 2:151670941-151670963 CATTGAATTAAGAAGGACGGAGG + Intronic
940376698 2:152966047-152966069 CAGTTAATAAAGGAGCAAGAGGG - Intergenic
940435189 2:153644668-153644690 CAGTGAATCAAGAAGTAGGGTGG - Intergenic
940525880 2:154812835-154812857 CTGTGAATAAAGCCGGAAAAAGG + Intronic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940789704 2:158019174-158019196 CAGTAAATAAAGGAGGAATCAGG + Intronic
941479209 2:165985055-165985077 CAGTGAATAAAGATGCATCAGGG + Intergenic
941953316 2:171178469-171178491 GAGTCAATGAAGAGGGAAGATGG - Intronic
941992658 2:171572276-171572298 CAGCAAATAAAGTAGGAAGCAGG + Intergenic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942522104 2:176815521-176815543 GAGGGAAGAAAAAAGGAAGAAGG + Intergenic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
943231163 2:185254372-185254394 CATTGAATACAGCAGGAACAGGG - Intergenic
943954270 2:194166523-194166545 CAGTGGATTATGAAGGAACATGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944199885 2:197095305-197095327 CAGTGAGAAAAGAATAAAGATGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944818918 2:203409137-203409159 CAGTGAAAAGAGAAGGTAGTTGG - Intronic
944824637 2:203469195-203469217 GAGTAAATAGAGAACGAAGAGGG + Intronic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946472356 2:219974018-219974040 GAGTAAATACAGAAGGAAAATGG - Intergenic
946650650 2:221889980-221890002 CAGAGAATTAAGAAGGGAGTTGG + Intergenic
947042565 2:225940471-225940493 CAATGAAAAAAGAAGATAGATGG + Intergenic
947375413 2:229490194-229490216 CAGGGAATATAGCAGAAAGAGGG + Intronic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947499388 2:230660866-230660888 CAGAGAATCAGGAAGGAAGCTGG - Intergenic
948178252 2:235960600-235960622 ACCTGAACAAAGAAGGAAGAGGG - Intronic
948345387 2:237292655-237292677 CACTGAATAAACATGGAAAATGG - Intergenic
948419760 2:237850004-237850026 CATTGAATAAAGTAGCAACATGG + Intergenic
1169665822 20:8034200-8034222 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1169863870 20:10179340-10179362 CAAAGACCAAAGAAGGAAGAAGG - Intergenic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170881037 20:20296488-20296510 AAGGGAGTAAAGAAGGAAGGAGG - Intronic
1172284055 20:33728605-33728627 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1172626139 20:36348209-36348231 CAGTTACTGAAGAAGGAAGGAGG + Intronic
1172839536 20:37893904-37893926 CAGAGAGGAAAGAAGGAAGGAGG - Intergenic
1172974475 20:38895844-38895866 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974483 20:38895871-38895893 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974491 20:38895898-38895920 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1172974499 20:38895925-38895947 GAGGGAAGAAAGAAGGAAGGAGG - Intronic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173381547 20:42548813-42548835 CAGTCAATAAAGAAGAGGGAAGG + Intronic
1173464555 20:43270709-43270731 AAGAGAAAAAGGAAGGAAGAAGG + Intergenic
1173730690 20:45326329-45326351 AAGAGAACAAAGAAAGAAGAGGG + Exonic
1174091035 20:48047789-48047811 CAGTTAATAAGGAAGAAGGAAGG + Intergenic
1174643153 20:52062705-52062727 CAGTGAACAAAGAGAGGAGAGGG + Intronic
1174723615 20:52838963-52838985 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
1174974313 20:55314501-55314523 CAATGAGTTAAGAAGGAAGGAGG - Intergenic
1175030575 20:55949865-55949887 GAAAGAAGAAAGAAGGAAGAGGG + Intergenic
1175526961 20:59641512-59641534 GACTGAATAGAGCAGGAAGACGG - Intronic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1176216269 20:63949418-63949440 CTGTCAGTCAAGAAGGAAGACGG + Intronic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177303063 21:19275348-19275370 AAGAGCATAAAGAAAGAAGAAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178053463 21:28772782-28772804 TAGTGAATACAGAAGCAATATGG - Intergenic
1178220556 21:30653125-30653147 CATTGGAGAAAGAAGGGAGAAGG + Intergenic
1178523765 21:33307225-33307247 CAGTAAATAAAGTAGGAATCAGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178778954 21:35580931-35580953 TAGCGAATAAAGATGGGAGAAGG + Intronic
1179491145 21:41742311-41742333 CATTAAAGAAAGAAGGAAAAAGG + Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180180501 21:46116749-46116771 CCCTGAAGAGAGAAGGAAGAGGG - Exonic
1181090498 22:20469278-20469300 CAGGGAATTAAGAAGGTGGACGG + Intronic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182915869 22:34029938-34029960 CACAGAAAAAAGAAGGTAGATGG - Intergenic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1183078695 22:35442675-35442697 CAGTCATTAAAGAAGGAGGCAGG - Intergenic
1183166993 22:36155592-36155614 CACTGAACAAAGCAGGAAGAAGG - Intronic
1183172967 22:36201566-36201588 CAGTGAACAAAGCAGGAAGAAGG - Intronic
1183177729 22:36236924-36236946 GAGTGAACAAAGCAGGAAGAAGG - Intronic
1183180309 22:36255412-36255434 CAGTGAACAAAGCAGGAAGAAGG + Intronic
1183342470 22:37289231-37289253 GAGGCAAGAAAGAAGGAAGATGG - Intronic
1183652062 22:39162224-39162246 CTGTGAATCAAGTGGGAAGATGG + Intergenic
949282747 3:2365503-2365525 CAGTTAATAATAAAGGAACAAGG + Intronic
949562949 3:5219577-5219599 CCTTGCAGAAAGAAGGAAGAGGG - Exonic
949672222 3:6412356-6412378 CCTTGAAAAAAAAAGGAAGATGG + Intergenic
949737849 3:7194971-7194993 CAGCGAATAAGGAACCAAGAAGG - Intronic
950743975 3:15072433-15072455 CAATGAACCAAAAAGGAAGAAGG + Exonic
950786717 3:15443123-15443145 CAGCGAATTAAAAAGGAATATGG - Intronic
950791050 3:15472651-15472673 CAGAGAATAAAGAGAGAAAAGGG - Intronic
951342159 3:21501245-21501267 TAGGCAAGAAAGAAGGAAGACGG - Intronic
951964997 3:28372058-28372080 AAATGAAGAAAGGAGGAAGAAGG - Intronic
952097847 3:29976296-29976318 AAGTACTTAAAGAAGGAAGAAGG - Intronic
952196393 3:31079969-31079991 GAATGAAGAAAGAATGAAGAAGG - Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952521586 3:34164231-34164253 AGATGAACAAAGAAGGAAGAGGG - Intergenic
952583956 3:34868860-34868882 AAGAGAATAAAGAAGAAAAAAGG - Intergenic
952744238 3:36762850-36762872 CACTGAAGAAAGAACAAAGAGGG - Intergenic
952836225 3:37604658-37604680 CAGTGAGTAAAGAAAAGAGAAGG - Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953014163 3:39056810-39056832 GAGTGAACAAAGAAAGAAGGAGG + Intronic
953417621 3:42732009-42732031 CAGTAAAGAGAGCAGGAAGATGG - Intronic
953719148 3:45340162-45340184 CATTGAAAATAGAAGGAAGTTGG - Intergenic
953991509 3:47487413-47487435 CAGTAAATAAACAAGGAATCAGG + Intergenic
954264075 3:49459830-49459852 GAGTGAATAAGGAAAGAGGAGGG - Intergenic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
955603441 3:60672774-60672796 AAGGCAAGAAAGAAGGAAGAAGG - Intronic
956060293 3:65342078-65342100 CAGTGCATAAAGCGGGCAGAGGG + Intergenic
956128372 3:66032616-66032638 CAGACAATAAAGAAGAAACAGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956492285 3:69785892-69785914 CCGTGGATGAAGGAGGAAGAGGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956877574 3:73478796-73478818 CAGTGAAGAAAAAAGCAACATGG - Intronic
957149678 3:76469935-76469957 AAATGAATAAAGAAAGAAAAAGG + Intronic
957304244 3:78436329-78436351 CAGTGAATGATTATGGAAGATGG - Intergenic
957314500 3:78559869-78559891 CATGGAATAAAGGAGCAAGAAGG + Intergenic
957411799 3:79851044-79851066 CAGTGAATAAAGAAAGAATGAGG + Intergenic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957613703 3:82502184-82502206 CAGTGAAAAATCAATGAAGATGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958699933 3:97575877-97575899 TAGTGAAGATAGAAGAAAGAGGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959029477 3:101281345-101281367 GAGTTAGTAAAGAAGGAAGTTGG + Intronic
959177052 3:102926669-102926691 CACTGAATAAAGGAGGGAAAGGG + Intergenic
959232926 3:103680208-103680230 CAGTGAATAAAGAAGTCATCTGG - Intergenic
959235301 3:103713824-103713846 AAGAAAATAAAGAAAGAAGAGGG + Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959589294 3:108059896-108059918 TAGTGAAGACAGCAGGAAGAAGG - Intronic
959962898 3:112320749-112320771 CAGGAAAGAAAGAAAGAAGAAGG + Intergenic
960356184 3:116656196-116656218 GAGGGAATAAAGAAGGGAGAGGG - Intronic
960746362 3:120894250-120894272 CATTAAATAAAGAAGGATTATGG + Intergenic
960872986 3:122268725-122268747 AAATGAATAAAGAAAGAAAATGG + Intronic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961113105 3:124302128-124302150 GAGTGAATAAAGAAGAGATAAGG - Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962597520 3:136961582-136961604 AAGTGATTAAAAAAGGATGAGGG + Intronic
963644688 3:147898829-147898851 TAATCAAGAAAGAAGGAAGAAGG - Intergenic
965902357 3:173657751-173657773 GATGGAAGAAAGAAGGAAGAGGG + Intronic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
966478429 3:180377166-180377188 CAGTCAATAAAGTAGGAATCAGG - Intergenic
966537095 3:181046921-181046943 CAAAGAATAAAGAAAGAAAAGGG - Intergenic
966757582 3:183385902-183385924 CAGTGTCCAAAGCAGGAAGAAGG - Intronic
966935779 3:184707973-184707995 CAGTGTCTGAAGAAAGAAGATGG + Intergenic
967112273 3:186304365-186304387 GAGAGAATGAAGCAGGAAGAAGG - Intronic
968361918 3:198153350-198153372 CAAACAAAAAAGAAGGAAGACGG + Intergenic
969063639 4:4460029-4460051 CAGTTTATAAAGAAGGATTAGGG - Intronic
970953158 4:21780008-21780030 CAGTGATTTAAGAAGGAACTCGG + Intronic
970998918 4:22300793-22300815 TGGAGAATAAAGAGGGAAGAAGG - Intergenic
971085098 4:23265866-23265888 CAGTAAAGAAAGAAGATAGAAGG - Intergenic
971178205 4:24302125-24302147 AAATGAACCAAGAAGGAAGATGG - Intergenic
971430938 4:26566603-26566625 CAGGGAAGAATGTAGGAAGAAGG - Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971498729 4:27295918-27295940 AAGTGAATAAAGAGAAAAGAGGG + Intergenic
971750842 4:30645864-30645886 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
972491086 4:39587749-39587771 CAAAGAAGAAAGGAGGAAGAAGG + Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
973145011 4:46814286-46814308 CAGTGAATAAGGAAACAAAATGG - Intronic
973624959 4:52762421-52762443 CTGTGAATAAAAGAGGAAGAGGG - Intergenic
974247499 4:59339578-59339600 CAGAGGATAAAGAAGAGAGAAGG + Intergenic
975902997 4:79175277-79175299 CAGTGAATAAAAACTGAAGATGG + Intergenic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976136368 4:81941175-81941197 CAGTGAATAAAAGTGAAAGAGGG - Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976433798 4:84993813-84993835 CAAAAAATAAAAAAGGAAGAGGG + Intergenic
976519695 4:86012301-86012323 CAGGGAATAAATAAGAAATAAGG - Intergenic
976633263 4:87261262-87261284 AAATAAATAAAGAAGGAAGCTGG + Intergenic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977700911 4:100021749-100021771 GAGGAAAGAAAGAAGGAAGAGGG - Intergenic
977811307 4:101358801-101358823 CAAAGATGAAAGAAGGAAGACGG + Intergenic
977827780 4:101553961-101553983 CAGTGAATAAAGTAGTATGTAGG + Intronic
977835879 4:101646029-101646051 CTGAGAATAAAGAAGTAAAAAGG + Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978264736 4:106810242-106810264 GAGAGAAGAAAGAAGAAAGAAGG - Intergenic
978352881 4:107838892-107838914 CAGTGGCTACAGAAGGCAGATGG - Intronic
978699014 4:111619931-111619953 GAGTGAATAAATAGGAAAGAAGG + Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978735523 4:112079978-112080000 AAGTGAATACATAAGAAAGAAGG - Intergenic
979119986 4:116886140-116886162 GAATCAATATAGAAGGAAGAAGG - Intergenic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980389956 4:132131688-132131710 CAGTGAGGATAGAAAGAAGATGG + Intergenic
980400454 4:132277327-132277349 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
980409410 4:132396993-132397015 AAGTTAATAAATAAGCAAGAAGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
980786438 4:137562157-137562179 CAGGGAATAAATAAGGAATAAGG - Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981274997 4:142888772-142888794 CAGCTAATGAATAAGGAAGAGGG + Intergenic
981282070 4:142969921-142969943 GAGGCAATAAAGAAGGACGAAGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981569620 4:146137616-146137638 CAGTGATCAAAGTAGGAAGATGG + Intergenic
981753574 4:148117685-148117707 TAGTGATCAAAGCAGGAAGAGGG - Intronic
981813981 4:148807491-148807513 GAGAGAACAAAAAAGGAAGAAGG + Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982220416 4:153119878-153119900 CAGTAAATAAAGTAGGAATCAGG + Intergenic
982551456 4:156805787-156805809 CAGTGAATATTGAAGTGAGAGGG - Intronic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
984068206 4:175076918-175076940 CAGTCAATAAATAAGGAAATAGG + Intergenic
984068221 4:175077184-175077206 CAGTCAATAAATAAGGAAATAGG - Intergenic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
985362642 4:189192155-189192177 CAGTAAGTAAAATAGGAAGAAGG + Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986232417 5:5878710-5878732 AAGTGAAAAAAGAAGAAAAAGGG - Intergenic
986573689 5:9191175-9191197 AAAGGAATAAAGAAGGAAGAAGG + Intronic
987428791 5:17805556-17805578 CCTTCAAGAAAGAAGGAAGAAGG - Intergenic
987436373 5:17898977-17898999 CAGTGAAAAAGGGAGAAAGAAGG - Intergenic
987463696 5:18246983-18247005 CAGTAAATAAAGTAGGAATCAGG - Intergenic
987479381 5:18433549-18433571 CAGATAACAATGAAGGAAGATGG - Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988570707 5:32362401-32362423 CAGAGACAAAGGAAGGAAGAGGG + Intronic
988882222 5:35516080-35516102 CAGTAAATAAGGTAGGAACAGGG + Intergenic
989060702 5:37408479-37408501 AATTGAAAAAAGAAGGTAGAGGG + Intronic
989107826 5:37880077-37880099 CAGTCAAGAAAGAAGAAAGCTGG + Intergenic
989411911 5:41129301-41129323 GAGAGAAAGAAGAAGGAAGAAGG - Intergenic
989502696 5:42187732-42187754 TAGTGAATACAACAGGAAGAAGG + Intergenic
989559995 5:42839367-42839389 ATGTGAATAAAGAGAGAAGATGG + Intronic
989627970 5:43450317-43450339 CAATGAATAATGAAAGAAAATGG + Intronic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
989994369 5:50810692-50810714 GTGTGAATAAACAAGGAAAAGGG + Intronic
990293439 5:54378368-54378390 CAGTTGATATAGAAGGGAGAGGG + Intergenic
990816412 5:59790725-59790747 GAAACAATAAAGAAGGAAGACGG - Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
992852027 5:80820122-80820144 AAGTGAATAAATAAGGATGAGGG + Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993473782 5:88339157-88339179 CAATGAATTAAGAATTAAGAAGG + Intergenic
993747871 5:91624118-91624140 GAGGGAAGAAGGAAGGAAGAGGG + Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
995156080 5:108915059-108915081 CAGTGAACAAAGGACTAAGAAGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995532188 5:113102755-113102777 CAGTGGATAATGAAACAAGAGGG + Intronic
995921292 5:117317141-117317163 CAATTAATAAAGAAGGGAAAGGG - Intergenic
995995988 5:118300031-118300053 AAGTGAAAAAGGAAGAAAGAAGG + Intergenic
996138931 5:119880480-119880502 AAATGATTAAAGAAGAAAGATGG + Intergenic
996361195 5:122649109-122649131 CAGAAAATAAAGAAGAAATATGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998331266 5:141329564-141329586 CAGTGATTAAAAAAAAAAGAAGG + Intergenic
998456490 5:142277857-142277879 CTGTGAATGAAGAACAAAGAGGG - Intergenic
998582261 5:143389529-143389551 CAGTAAATAAGGAAGCCAGAAGG - Intronic
998604068 5:143615606-143615628 AGGAGAAGAAAGAAGGAAGAAGG - Intergenic
998855048 5:146386602-146386624 CAGTGAATTAAGAAGTAACTAGG - Intergenic
999010881 5:148038550-148038572 CACTGAAAAAAAAAGAAAGATGG - Intronic
999398610 5:151247456-151247478 CAGTTAATAAAGAATCAAGGAGG - Intronic
999467346 5:151820316-151820338 TAATGAGTAAAGTAGGAAGAAGG + Intergenic
999505860 5:152195273-152195295 CAGTGAAAAATGAATTAAGAAGG - Intergenic
999585537 5:153085747-153085769 GAGAGAAGGAAGAAGGAAGAAGG + Intergenic
1000437167 5:161226521-161226543 TAGTGAAAAAAGAAAAAAGATGG + Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1001268794 5:170295328-170295350 CAGTTAATAGAGAAGGTAAAAGG + Intronic
1001919427 5:175588710-175588732 GAGGGAAGAAGGAAGGAAGAAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1003047405 6:2746376-2746398 CATAGAGGAAAGAAGGAAGATGG + Intronic
1003321845 6:5058682-5058704 AGGGGAATAAAGAAGGCAGAAGG - Intergenic
1003435769 6:6086577-6086599 CAGTGAAAAAATAAGGAAATAGG - Intergenic
1003662278 6:8073894-8073916 CAATGAGAAAAGAAGGAAAAGGG - Intronic
1004761533 6:18672130-18672152 CAGAGAAGAAAAAAGGGAGAAGG - Intergenic
1004816756 6:19319349-19319371 CAGAGAAGAAAGAATGAAAAAGG - Intergenic
1004939698 6:20542823-20542845 CAGGGATTAAAGAAAGAACAGGG - Intronic
1005527683 6:26667270-26667292 CAGTCAAGAAAGAAGGAAAATGG - Intergenic
1005543111 6:26834408-26834430 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1005838059 6:29723047-29723069 GAATGAATAATGAAGGGAGATGG + Intronic
1005975949 6:30799401-30799423 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1006006066 6:31002597-31002619 CAGTAAATAAAGTAGGAATGAGG + Intergenic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1007385545 6:41518067-41518089 CAGGGAGGAAAGAAGGGAGAGGG - Intergenic
1007994646 6:46293615-46293637 TACTCAATAAAGAGGGAAGAAGG - Intronic
1008475535 6:51931912-51931934 AGGAGAATAAAGAAGAAAGAGGG + Intronic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1009013929 6:57876578-57876600 CAGTCAAGAAAGAAGGAAAATGG + Intergenic
1009318187 6:62250504-62250526 AAGTAAAGAAGGAAGGAAGAAGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010142743 6:72630354-72630376 CACTGACTGAAGAAGGAATAGGG - Intronic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011290119 6:85768243-85768265 TAGTGAATTAAGAAGGAAAATGG + Intergenic
1011899220 6:92271461-92271483 GAGAGAACAAAGAAGGAAAATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012210852 6:96517079-96517101 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1012635890 6:101541196-101541218 CAGTGAATTAGAAAGGAAGTTGG + Intronic
1012732698 6:102902045-102902067 AAGGGAATAAAGAATGAAGGAGG + Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1013127053 6:107194470-107194492 CAATGAAGAAAGAAGAAAAAGGG - Intronic
1013420957 6:109966415-109966437 TAGTGACTTAAGAAAGAAGAGGG + Intergenic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013976338 6:116083059-116083081 CAGTCAATGAAGAAGGAGTAGGG + Intergenic
1014492512 6:122080136-122080158 CAGTAAATAAAGAGGTCAGAAGG + Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014552837 6:122808670-122808692 CAATAAATAAATAAGAAAGAAGG - Intronic
1014743208 6:125169881-125169903 CAGGAAATAAAAGAGGAAGAAGG - Intronic
1014791588 6:125678586-125678608 CTTACAATAAAGAAGGAAGAAGG - Intergenic
1014983716 6:127977055-127977077 CTGTGAAGAAACAAGGTAGATGG + Intronic
1015515951 6:134082753-134082775 CAGTAAATAAAGTAGGAAGCAGG + Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015938649 6:138427214-138427236 CATAGAATTAAGAAAGAAGATGG + Intronic
1016455434 6:144225615-144225637 AAGAGAAGAAAAAAGGAAGAAGG + Intergenic
1017600464 6:156075133-156075155 CAGTGAATTAATGATGAAGAGGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018917332 6:168143318-168143340 GAGTCAATAAAGAGGTAAGAAGG - Intergenic
1019253760 7:35372-35394 CAAACAAAAAAGAAGGAAGACGG - Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1020460375 7:8423552-8423574 AACTGAATAAAGATGGAAGGAGG - Intergenic
1020722134 7:11759519-11759541 CAGAGAATATAGAAAGAATAAGG + Intronic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1021006244 7:15397577-15397599 GAATGAAGAAAGAAGGAAGGAGG - Intronic
1021096111 7:16538182-16538204 TAGTTAATAAAGAAGGCAGGTGG - Intronic
1021450988 7:20784137-20784159 CACAGAAGGAAGAAGGAAGAGGG + Intronic
1021782107 7:24116376-24116398 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1022190560 7:28013349-28013371 CAGTGATTAAAGAAGACAGTGGG + Intronic
1022646227 7:32230684-32230706 CAGTGACTCAAGCAGGAAAAGGG - Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023658421 7:42449155-42449177 CAATGAATGAGTAAGGAAGACGG - Intergenic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1023894002 7:44417033-44417055 CAGTAAATAAATGAGCAAGATGG - Intronic
1023927546 7:44680972-44680994 GAGTAAATAAACAAGGGAGAAGG + Intronic
1024288345 7:47780250-47780272 CGGTGAGGAAGGAAGGAAGAAGG - Intronic
1024720360 7:52129864-52129886 AATTGAATTAAAAAGGAAGAAGG - Intergenic
1024833370 7:53487653-53487675 AGGGGAATGAAGAAGGAAGAAGG - Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1024878776 7:54060228-54060250 CAATGAATAAAGATTGAAGAAGG - Intergenic
1025080830 7:55981053-55981075 CACAGAAGAAATAAGGAAGATGG - Intronic
1025276946 7:57591010-57591032 CAGAGAGTAAAGAAGGACAAGGG + Intergenic
1025828561 7:65030776-65030798 CACTAAAAAAAGAAAGAAGAAGG + Intergenic
1025916083 7:65867183-65867205 CACTAAAAAAAGAAAGAAGAAGG + Intergenic
1026079723 7:67206984-67207006 CACAGAAGAAAGAAGGAATATGG - Intronic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028418007 7:90599621-90599643 CAATGAAGAAAGGAGGATGATGG - Intronic
1028439327 7:90840708-90840730 AAGTGAATAAAACAGGAAAAAGG - Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1031410605 7:121436706-121436728 TAGGCAAGAAAGAAGGAAGAAGG + Intergenic
1032190034 7:129759596-129759618 TAGTGAGGAAAGGAGGAAGAAGG + Intergenic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033729783 7:144166375-144166397 AAATGAATAAATAAGGAAAATGG - Intergenic
1033770271 7:144543188-144543210 CAAAGAATAAACAAGGAAAAGGG + Intronic
1033889586 7:145994842-145994864 AAAAGAAGAAAGAAGGAAGAAGG - Intergenic
1033937697 7:146607782-146607804 AAGTGATTTAAGAAGAAAGATGG - Intronic
1034020820 7:147640727-147640749 CAGGCAAGAAAGAAGGAAGGAGG + Intronic
1034634898 7:152559487-152559509 AAGGGAATAAAAAAGGAAGAGGG - Intergenic
1034835550 7:154348864-154348886 GGCAGAATAAAGAAGGAAGATGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035239792 7:157522085-157522107 CAGGGAATAAAGAAGAAAATAGG - Intergenic
1035742777 8:1941075-1941097 CTGTGAATAAAAATGGCAGAAGG - Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036536050 8:9653774-9653796 CAGAGAATGAAGCAGAAAGAAGG - Intronic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1038351514 8:26780155-26780177 AAGTGAATGAGGAATGAAGAAGG - Intronic
1038795249 8:30703857-30703879 GAAAGAAGAAAGAAGGAAGAAGG + Intronic
1038811188 8:30846574-30846596 CCGGAAATAAATAAGGAAGATGG - Exonic
1039053552 8:33515621-33515643 AAGAAAAGAAAGAAGGAAGAAGG - Intergenic
1039100949 8:33941588-33941610 CACGGAAAAAAGAAGTAAGAAGG - Intergenic
1040002629 8:42592000-42592022 AAGAGAATAAAGCAGGAAGCTGG - Intergenic
1040382928 8:46890487-46890509 AAGTAAATAAAGAACAAAGATGG - Intergenic
1041054816 8:53973872-53973894 CAGGCAATAAAGAAAAAAGAGGG + Intronic
1041191176 8:55356149-55356171 AAGTAAGTAAAGAAGGATGATGG + Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041453371 8:58031841-58031863 GAGAGAAGAAAGAAGGAAGGAGG - Intronic
1041528041 8:58830653-58830675 CAGAAAAGAAGGAAGGAAGAAGG - Intronic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042198027 8:66250133-66250155 CAGTAAATAAAGAAGAAATCAGG - Intergenic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1042540254 8:69900932-69900954 TAGTGAAGAAGAAAGGAAGAAGG - Intergenic
1043132726 8:76481778-76481800 AAGGGACTAAAGAAGGGAGACGG - Intergenic
1043183564 8:77116656-77116678 TAGTGAATTTAGAAGGAACAGGG - Intergenic
1043203481 8:77405316-77405338 CAGGGAAGAAAGAAGCAAAATGG + Intergenic
1043277054 8:78411300-78411322 CAGTGAAGAAAAATGGAATATGG + Intergenic
1043624753 8:82242973-82242995 CATTGGATGAAGCAGGAAGAAGG + Intergenic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1044914170 8:97094562-97094584 CAGAAAATAAAGAATGAAAATGG - Intronic
1045358755 8:101412949-101412971 TGGTGGATTAAGAAGGAAGAGGG - Intergenic
1045735551 8:105292532-105292554 AAGTGGATAAAGAAGGAAAGTGG + Intronic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046408918 8:113813224-113813246 GAGTGAATAAATGAGGAGGATGG - Intergenic
1046489004 8:114922929-114922951 CAATGAAAAAATAAGGGAGAAGG - Intergenic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047597149 8:126390219-126390241 TGATGAATAAAGAAAGAAGAAGG + Intergenic
1047773436 8:128049314-128049336 GAGTGAATGAGGAAGGAAGGCGG + Intergenic
1048611050 8:136023506-136023528 CCCAGAATAAAGAAGGTAGATGG - Intergenic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1050052109 9:1613365-1613387 TAGGGAATAAAGAAGAGAGAAGG - Intergenic
1050117087 9:2274470-2274492 CTGTTAAAAAAAAAGGAAGAAGG + Intergenic
1050348185 9:4714489-4714511 CAGTGAATTTAGAAGCAGGAGGG - Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050999301 9:12260318-12260340 CTGTGATCAAAGAAGGTAGAAGG + Intergenic
1051001050 9:12281978-12282000 CAGTAAATAAAGTAGGAATAAGG + Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051421585 9:16894331-16894353 CACTTAAAAAAGAAGCAAGATGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051960534 9:22756577-22756599 AAGTGAATAATGATGGCAGATGG - Intergenic
1052014628 9:23450767-23450789 TAGTGAGTAAACAAGGAAGCGGG - Intergenic
1052165624 9:25323432-25323454 CATTCACTAAAGAAGGTAGATGG + Intergenic
1052500060 9:29277533-29277555 AACTGAATAAAGAAAGAACATGG + Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053946356 9:43312877-43312899 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056106440 9:83351738-83351760 AAGTGAATAATGAAGCAGGATGG - Intronic
1056139534 9:83662651-83662673 CATGGAATAAATAAGAAAGAAGG - Intronic
1056232305 9:84559147-84559169 CAGTGAAGAAGGAAGGAATTAGG + Intergenic
1057422614 9:94924653-94924675 TAGTGAATGAAGAATGAAGCAGG + Intronic
1057957183 9:99419952-99419974 AAGTGATTCAAGAAGGAACAAGG - Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058204564 9:102087168-102087190 AAATGAATAAAGAAGGAAAATGG - Intergenic
1058300678 9:103368874-103368896 CAGTGAATAAGGGAGGTAAATGG - Intergenic
1058503675 9:105647768-105647790 CAGAGAATAAAGAAGGAAAGGGG + Intergenic
1058976454 9:110129224-110129246 GACTGAATAAAGAAGGTAAAGGG + Intronic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059974245 9:119698727-119698749 TCATGAATAAAGAAGAAAGAGGG + Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1060975607 9:127763150-127763172 CCCTGAATAAAGAGGGAGGAGGG - Intronic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062746636 9:138217171-138217193 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1203589486 Un_KI270747v1:41435-41457 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1185512532 X:674148-674170 CAGTGAATAAAGGAGCCAGCTGG + Intergenic
1185616693 X:1426337-1426359 CAGTGAATAAGGAATAAAGGTGG - Intronic
1186181741 X:6980178-6980200 AAGAGAAGAAGGAAGGAAGAAGG - Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1187131321 X:16506037-16506059 AAGTGAAAAGACAAGGAAGAAGG + Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1188005668 X:25014235-25014257 AAAGGAATAAAGAAGAAAGAAGG - Intronic
1188239949 X:27773796-27773818 CAGTGAATGAAGCAGGATGGGGG - Intergenic
1188582650 X:31733999-31734021 CAGTGAATAAAGAACAAAAAAGG - Intronic
1188781111 X:34286558-34286580 CACTGAAGAAAGAAGGAGGCTGG + Intergenic
1189196364 X:39156762-39156784 CAGTGGATAAAGTAGGAATGAGG + Intergenic
1189368125 X:40405626-40405648 CAGTGAATCCAGAAGGAAAAAGG - Intergenic
1190060643 X:47209523-47209545 CAGTGAATAAAGCAAGTACAAGG - Intronic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1191821796 X:65318348-65318370 GAAGGAAGAAAGAAGGAAGAAGG - Intergenic
1191870879 X:65743785-65743807 GAGTCATTAAAGATGGAAGAGGG + Intergenic
1191954790 X:66632480-66632502 GAAGGAAGAAAGAAGGAAGAAGG + Intronic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1194164164 X:90494082-90494104 CATTGAATAAATAAAGTAGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195295357 X:103471189-103471211 GAGTGAATACACAAGGAAAATGG + Intergenic
1195447852 X:104974605-104974627 CATCAAATAAAGAAGGAAGCTGG + Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195654286 X:107320314-107320336 CAGTGCACAAGAAAGGAAGAGGG - Intergenic
1195658801 X:107358728-107358750 GAGTGAGGAAGGAAGGAAGAAGG + Intergenic
1195944776 X:110198135-110198157 CAGGGAAGGAAGAAGGAAAACGG + Exonic
1196560034 X:117135254-117135276 CAGTAAGTGAAGAAGGAAAAGGG - Intergenic
1196779561 X:119371176-119371198 CAATGAATAAAAAAAGAAAATGG - Intergenic
1197187210 X:123601257-123601279 CCGAGAATTAAGAATGAAGAGGG - Exonic
1197357361 X:125452128-125452150 CAGTGCCTAAAGGAGGAAAAGGG + Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198036243 X:132804143-132804165 CAGTGAATAAATATGGCAAAAGG + Intronic
1198241830 X:134795557-134795579 CAGTGAATAAAAAAGAAGGGTGG - Intronic
1198269472 X:135041701-135041723 AAGTGAGAAAAGAAGGAAGGAGG + Intergenic
1199934201 X:152555396-152555418 CAGTCAATAAATAAGAAATACGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1200510424 Y:4071892-4071914 CATTGAATAAATAAAGTAGAGGG - Intergenic
1200775831 Y:7169598-7169620 CACTGAATAAAGAAAGGAAAGGG + Intergenic
1200893560 Y:8349694-8349716 CAGTTATTAAAAAATGAAGATGG - Intergenic
1200895659 Y:8373578-8373600 AAGTGAATACAGAAGAAAGTTGG - Intergenic
1201458098 Y:14193378-14193400 CATTGAACAAAGAAGGAGAAAGG + Intergenic
1201550250 Y:15211126-15211148 GAGAGAAGAAGGAAGGAAGAGGG + Intergenic
1202173820 Y:22079355-22079377 GTGGGCATAAAGAAGGAAGAAGG + Intronic
1202217540 Y:22507027-22507049 GTGGGCATAAAGAAGGAAGAAGG - Intronic
1202254782 Y:22909704-22909726 AAGTAAATAAAGAACAAAGATGG + Intergenic
1202325645 Y:23689032-23689054 GTGGGCATAAAGAAGGAAGAAGG + Intergenic
1202407773 Y:24543453-24543475 AAGTAAATAAAGAACAAAGATGG + Intergenic
1202463009 Y:25126628-25126650 AAGTAAATAAAGAACAAAGATGG - Intergenic
1202545126 Y:25981022-25981044 GTGGGCATAAAGAAGGAAGAAGG - Intergenic