ID: 1133985443

View in Genome Browser
Species Human (GRCh38)
Location 16:10664815-10664837
Sequence TCTCATCTGCTGATGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133985443 Original CRISPR TCTCATCTGCTGATGTGGGA GGG (reversed) Intronic
900130366 1:1084781-1084803 TCCCCTCTGCTGAGGCGGGAAGG - Intronic
901840151 1:11949258-11949280 TCAAATCTCCGGATGTGGGAGGG + Intronic
901870790 1:12138218-12138240 ACTCCTCAGCTGCTGTGGGACGG - Exonic
903771462 1:25767010-25767032 CCCCATCTGCAGATGTGTGAAGG - Intronic
904349215 1:29894041-29894063 TCTCATCTGTTGATTTAGAAAGG + Intergenic
905111318 1:35596697-35596719 TGTCATCTACTGTGGTGGGATGG - Intergenic
906233950 1:44191783-44191805 TCTCATCTGCTGGTTTCTGATGG + Intergenic
906919195 1:50045943-50045965 CCTCATCAGCTGACGTGGGGAGG + Intergenic
907834681 1:58097767-58097789 GCTCAACTGCTGTGGTGGGAGGG + Intronic
909378957 1:74974981-74975003 ACTCATCTCCAGATTTGGGATGG - Intergenic
912126288 1:106542805-106542827 TCTCATCTGTTGATATGGTTTGG - Intergenic
913044877 1:115065385-115065407 TCACACCTGCTCCTGTGGGAAGG - Intronic
917205422 1:172566019-172566041 GCTCAGCTGCTGCAGTGGGAGGG + Intronic
917468063 1:175300929-175300951 ACTTTTCTGCTGATTTGGGATGG - Intergenic
917523028 1:175763584-175763606 CCTCAACTGCCAATGTGGGATGG - Intergenic
918056856 1:181029358-181029380 TCTCATGTGTTGTGGTGGGAGGG + Intergenic
918316280 1:183325130-183325152 CCTGATCTGCTGAAGTGGGAAGG + Intronic
918318501 1:183343104-183343126 TGACATCTGCTGACATGGGAAGG - Intronic
918396475 1:184118265-184118287 TCTGATATGCTGATGTGCCAGGG + Intergenic
918409101 1:184240143-184240165 ACTCAGCTGCTGATGCAGGAAGG + Intergenic
918588299 1:186212852-186212874 TCTCATCTGAAGATCTTGGAAGG - Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
921741619 1:218691737-218691759 TATCATCTTCTAATGAGGGAAGG + Intergenic
1062937503 10:1399347-1399369 TCTCATCTGCAAATCTGGGGTGG - Intronic
1064035052 10:11908145-11908167 TCTCGCCTGCTGCTGTGGGAAGG + Intergenic
1067539547 10:47141807-47141829 TCTTTACTGCTGATGGGGGATGG + Intergenic
1073235140 10:102008000-102008022 TCTCAAGAGCTGATGTGGGAGGG - Intronic
1074587779 10:114785248-114785270 TCTCAACATCAGATGTGGGAAGG + Intergenic
1075323477 10:121511132-121511154 TCTCAGCTGCTGATATAGGTAGG - Intronic
1078128566 11:8593359-8593381 TCTTAGCTGGTGATATGGGACGG + Intronic
1081402261 11:42656966-42656988 TGTGATCAGCTGATGTAGGAGGG - Intergenic
1081591381 11:44425587-44425609 TCTCACCTGCTGGGGTGGGGTGG - Intergenic
1082046320 11:47731784-47731806 TCTCATCTGTTGGAGTGAGAGGG - Intronic
1082763546 11:57148865-57148887 TCTCAACTCCTCATGTGAGAAGG + Intergenic
1088453540 11:110009262-110009284 TGTCCTCTGCTGATCTAGGAGGG - Intergenic
1091413069 12:257019-257041 CCTTTGCTGCTGATGTGGGAAGG - Intronic
1093413399 12:18893691-18893713 TCTAGTCTGTTGATTTGGGATGG + Intergenic
1100555547 12:95689679-95689701 TCACATTTGGTGAGGTGGGAAGG - Intronic
1101179688 12:102201522-102201544 TCTTAGATGCTGTTGTGGGAGGG + Intergenic
1103460012 12:121096217-121096239 GCTCTTCTGCTGACGTGGGTTGG - Intergenic
1103535458 12:121630639-121630661 TCTCATCTGCAGATCAGAGAGGG - Intronic
1103634886 12:122295575-122295597 TGTCTTCTGCTGCTGTTGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1105893668 13:24700126-24700148 TCTCATAGGCTGAGGTGGAAGGG - Intronic
1107651484 13:42549617-42549639 TCTCTTCTGAAGGTGTGGGAGGG + Intergenic
1109381495 13:61567642-61567664 TCTCTTATGCTGAGATGGGATGG - Intergenic
1112684252 13:101804596-101804618 ACACATATGCTGATGTGGGAAGG + Intronic
1114256175 14:21003192-21003214 TCTCATATGCTGATCTGTGAGGG - Intergenic
1115512632 14:34152735-34152757 TATATTCTGTTGATGTGGGATGG - Intronic
1116407342 14:44581592-44581614 TCTCTTCTGTTGATTTGGGGTGG - Intergenic
1116684949 14:48027481-48027503 CCTCATCAGCTGATGTGAGCTGG - Intergenic
1119692213 14:76683397-76683419 GTTCATCTGCTGGTGTGGGCTGG + Intergenic
1119980438 14:79074805-79074827 TCTCATATGCTGATCTGTGAGGG + Intronic
1124690307 15:31816138-31816160 TTTCATCTTCTGATATGGGCTGG - Intronic
1127220004 15:56869917-56869939 TCTCACAAGCTGATGTGGGAAGG + Intronic
1127811847 15:62572003-62572025 TCTGATGTGCTGATATGGGAGGG + Intronic
1130168527 15:81487212-81487234 TATCTTCTGCTGGTGTGGGAAGG - Intergenic
1131160056 15:90099819-90099841 GCTCAAATTCTGATGTGGGAGGG - Intronic
1131679190 15:94703456-94703478 TCTTATCTGCTGTTGAGGGTTGG - Intergenic
1132792471 16:1699360-1699382 TGTCCACTGCTGCTGTGGGATGG + Exonic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135973900 16:27093417-27093439 TATATTCTGCTGATGTTGGATGG - Intergenic
1136085210 16:27880116-27880138 TCTGCTCTGCTCCTGTGGGAGGG - Intronic
1136293017 16:29287173-29287195 CCTCAGCTGCTGATGCGGGTGGG + Intergenic
1138048036 16:53746355-53746377 TCTAATATGTTGATGGGGGAAGG - Intronic
1139064063 16:63291228-63291250 TCTCACCTGCTGATATGGAAGGG + Intergenic
1140216014 16:73009668-73009690 TGCCATCTGCTGCTGGGGGATGG - Intronic
1142098902 16:88261180-88261202 CCTCAGCTGCTGATGCGGGTGGG + Intergenic
1143836620 17:9698024-9698046 AGCCATCTGCTGATGTGAGATGG + Intronic
1144038563 17:11388461-11388483 TCGGATCTGCATATGTGGGACGG + Intronic
1144777468 17:17791979-17792001 CCTCACCTGCTGAGGTGGGGAGG + Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145978534 17:28998060-28998082 ACTCAGCTGCTGAGCTGGGAGGG + Intronic
1147427772 17:40354493-40354515 CCTCATCTGCGGAGGTGGGCAGG + Exonic
1149284327 17:55145375-55145397 TCTCTTCTGGTGTTCTGGGAGGG - Intronic
1150311448 17:64131983-64132005 TTTCATCTGCTGATGTTACAGGG - Intergenic
1151424336 17:74020794-74020816 TTTCATTTGCTGAGGAGGGAGGG - Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1153690319 18:7585779-7585801 TCTCCTCTGCAGATGTGGACAGG + Intronic
1160129388 18:76211202-76211224 TCTCTCCTGGTGATGTGGCAAGG + Intergenic
1160629324 18:80234370-80234392 TCCCTACTGCTGATGTGTGAAGG - Intronic
1161651098 19:5485576-5485598 GCTGATCTGCAGATGTGAGAAGG + Intergenic
1162728554 19:12703945-12703967 TCCCATTTGCAGATGTGGGCTGG - Intronic
1164248932 19:23459878-23459900 TCTCATTTGCTAAGTTGGGATGG + Intergenic
1164673556 19:30087448-30087470 TGTCATGTGGTGAGGTGGGAAGG - Intergenic
1164706821 19:30325936-30325958 GCACATCTGCGGGTGTGGGAGGG - Intronic
1165407736 19:35641413-35641435 TCTCATTTGATGAAGGGGGAAGG - Intergenic
1165601148 19:37056668-37056690 CCTTATCTGTTGAGGTGGGAAGG - Intronic
1166939607 19:46354850-46354872 TGTGATATGCTGATGAGGGAGGG + Intronic
925260467 2:2524289-2524311 TCTGCTCTGCTGACTTGGGAGGG + Intergenic
925530630 2:4857550-4857572 CATCATCTGCTGATATGGTAAGG + Intergenic
926120140 2:10237365-10237387 ACTCCTCTGCTGCTGTGGGCAGG - Intergenic
933052310 2:77614614-77614636 TCTATTCTGCTGTTTTGGGATGG - Intergenic
933231285 2:79810427-79810449 TCTCATCTCATGTTGTGGGAGGG - Intronic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
938768829 2:134482648-134482670 TCTCATCTGCTGGTTGGGGGTGG - Intronic
939676554 2:145079479-145079501 TTTCATCTGCTGCTGGGGGTGGG - Intergenic
940091872 2:149929153-149929175 TCTAATATGATGAAGTGGGAAGG - Intergenic
940124508 2:150309411-150309433 TCTCATCTTGTGATGTGCTATGG - Intergenic
942893445 2:181020067-181020089 TCTTATCTGTTTTTGTGGGAAGG + Intronic
943075782 2:183192619-183192641 TCTCCTCTGCTGTTGTAGAATGG + Intergenic
943168535 2:184365012-184365034 TCAAATCTGCTGATTTGGGTTGG + Intergenic
945056335 2:205872603-205872625 TCTTGTCTGCTGCAGTGGGAGGG + Intergenic
946913285 2:224487770-224487792 TATATTCTGTTGATGTGGGATGG - Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
1168866626 20:1092131-1092153 TTCCATCTGCTGCTGTGGTAAGG + Intergenic
1170701485 20:18707815-18707837 TCTCTTCAGCTGATCTGAGAAGG - Intronic
1172601220 20:36184588-36184610 TCACATGTGCTGACATGGGAGGG + Intronic
1173078933 20:39847555-39847577 ACTCATGTGTTGAAGTGGGATGG - Intergenic
1173192989 20:40890401-40890423 TCTCCTCTGCTGCTGGGTGAGGG - Intergenic
1173497252 20:43528646-43528668 TCTCACCTGTTGCTGTGGAAAGG - Exonic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1177576890 21:22969146-22969168 TCTGTTCTGCTGAAGTGGGACGG - Intergenic
1179106235 21:38403312-38403334 TCTCATCAGGTGATGTGGCCAGG + Intronic
1179203490 21:39249548-39249570 TCTCATCTGCTTTTGTGGTTGGG - Intronic
1180731965 22:17988911-17988933 TCCCCTCTGCTGTTGTGTGAAGG - Intronic
1181181863 22:21074109-21074131 GCTCATCTGCTCATGGGAGATGG - Intergenic
1184258475 22:43300975-43300997 TCTATTCTGCTTTTGTGGGAGGG - Intronic
1185079272 22:48700775-48700797 TCTGAACTGCTGAAGTGGGACGG - Intronic
1185105573 22:48867678-48867700 TCTCCTCTGGGGTTGTGGGAAGG + Intergenic
949770957 3:7577678-7577700 TGTCATCTGCAAATGGGGGATGG + Intronic
950258981 3:11530163-11530185 TCATGTCTGCTGAGGTGGGAAGG - Intronic
950432683 3:12960015-12960037 TTTCCTCTGCTGCTGGGGGAGGG - Intronic
952520257 3:34149828-34149850 TCTCAGCAGCTGAAGTGGGGCGG + Intergenic
954926518 3:54240667-54240689 TCTCATCTGCTGGTTTTGTAAGG + Intronic
954951533 3:54478794-54478816 TCAGATCTGCTGTTGTGGTATGG + Intronic
955631403 3:60979381-60979403 TTCAGTCTGCTGATGTGGGAAGG - Intronic
956422908 3:69103246-69103268 TCTCAGGTTCTGATGTGGAAAGG - Intronic
959235478 3:103716958-103716980 TGTATTCTGCTGATGTTGGATGG + Intergenic
962038833 3:131683528-131683550 TCTCCTCTCCTCAAGTGGGAGGG + Intronic
963065316 3:141259156-141259178 GCTCATCTGCTAATGTGTGAGGG - Intronic
963435455 3:145259964-145259986 TCTCTTCAGCTGATGTGTGATGG - Intergenic
964907301 3:161733119-161733141 TCTCAAATTCTAATGTGGGATGG + Intergenic
965977948 3:174648453-174648475 TATCCTCTGCAGATATGGGAGGG + Intronic
966207558 3:177420482-177420504 CCTCATCTGCTGTTGTGTGAAGG + Intergenic
966705959 3:182913978-182914000 TCACACCTGCTGATGTGGGTTGG - Exonic
966981757 3:185142781-185142803 TCTCATGTGATGCTGTGAGAAGG + Intronic
968001795 3:195211658-195211680 TATCGTCTGCTCATGTGGAATGG - Intronic
970531107 4:16985365-16985387 TCTCAGCTGCTGAGGTGGAAGGG - Intergenic
972004609 4:34084328-34084350 TGTCATCTGCTGTTATAGGATGG + Intergenic
975336391 4:73181585-73181607 TCTCAGCTGGGGATGTGGTATGG - Intronic
975553530 4:75637431-75637453 ACTCAGGGGCTGATGTGGGAGGG - Intergenic
975728703 4:77317278-77317300 TCTCATCTGCTGATGGCTCAGGG - Intronic
976794995 4:88922224-88922246 TATATTCTGCTGATGTGGGGTGG - Intronic
981645787 4:146997247-146997269 TATCATCTGCTCATGTGGCTTGG + Intergenic
981675727 4:147340733-147340755 GCCCACCTGCTAATGTGGGAAGG + Intergenic
983025598 4:162733292-162733314 AGCCATCTGCTGATGTGGAAAGG - Intergenic
985025087 4:185732588-185732610 TCAGTTCTGCAGATGTGGGAAGG + Intronic
985508780 5:300049-300071 TTTGATCTGCCTATGTGGGAAGG + Intronic
985739344 5:1605867-1605889 TTTGATCTGCCTATGTGGGAAGG - Intergenic
985803632 5:2022221-2022243 TCTCACCTCCTGCTGTGGGATGG + Intergenic
985994726 5:3591575-3591597 TCCCAGCTGCTGCTGAGGGACGG + Intergenic
988352752 5:30133021-30133043 TATACTCTGCTGATGTTGGATGG + Intergenic
991420225 5:66433137-66433159 TCTCACCTTCTGATGTGGTTTGG - Intergenic
996519666 5:124413020-124413042 ACTCACCTACTGTTGTGGGAGGG - Intergenic
996849752 5:127938857-127938879 CCTCATCTCCTGATGTGCCAGGG - Intergenic
997811600 5:136975693-136975715 TGTCATTTGCTGCTGTGGGTAGG + Exonic
1000291745 5:159877333-159877355 TCCCATCTGGTGCAGTGGGAGGG - Intergenic
1001098776 5:168796842-168796864 TCTCAGCTGCTAATGTGGAATGG + Intronic
1001604542 5:172950620-172950642 CATCATCTCATGATGTGGGAGGG + Intronic
1001797144 5:174511853-174511875 TCTCATCTGTTGCTGTGGAATGG + Intergenic
1003132369 6:3405755-3405777 TCTAATGTGCTGGTGTTGGATGG - Intronic
1003415069 6:5899701-5899723 TCAAATCTCCTGAAGTGGGAGGG - Intergenic
1006446716 6:34083862-34083884 GGTCATCTGATGAGGTGGGAGGG + Intronic
1013755377 6:113455648-113455670 TCTCATCTGCTGATATGGTTTGG + Intergenic
1014601628 6:123419885-123419907 TTTCTACTGCTGATGTAGGAAGG - Intronic
1016321228 6:142848251-142848273 TCTTATCTATGGATGTGGGATGG + Intronic
1016803786 6:148192347-148192369 ACTCATGTGTAGATGTGGGAGGG + Intergenic
1017321760 6:153102507-153102529 TCTCATCTCGTGTTGAGGGAGGG + Intronic
1017637953 6:156461574-156461596 TATCATCTGCTGTTGTGTGCTGG + Intergenic
1018252709 6:161888245-161888267 TGTCATATGCTGATATTGGAGGG - Intronic
1018858875 6:167696344-167696366 TCCCATCCTCTGATGGGGGAGGG + Intergenic
1019171067 6:170133459-170133481 TCTCATCTGCCTATTTGGGTAGG + Intergenic
1022828407 7:34040201-34040223 GTTCAGTTGCTGATGTGGGAAGG + Intronic
1023455766 7:40337216-40337238 TATATTCTGCTGATTTGGGATGG + Intronic
1026104930 7:67413399-67413421 TCCCAACATCTGATGTGGGATGG + Intergenic
1026371435 7:69703624-69703646 TCTCATCTGCTGGTTTGGTCAGG + Intronic
1027179305 7:75926941-75926963 TGTCATCTGATGATGTGGCCAGG + Intronic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1029035447 7:97515598-97515620 TATCCACTGCTGGTGTGGGAAGG - Intergenic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1032019786 7:128400883-128400905 TCCCATCAGCTGATGTAGAAGGG + Exonic
1032423946 7:131805400-131805422 TCTCAGCTGTTGATGTTGGAGGG + Intergenic
1033516094 7:142108102-142108124 TCTCATGTGCAAATTTGGGAGGG - Intergenic
1034818799 7:154197949-154197971 TCCCAGCAGCTGCTGTGGGAGGG - Intronic
1036114770 8:5946618-5946640 TCTCACCTGTTGATGTGGTTTGG - Intergenic
1036710650 8:11076452-11076474 GCTCCTCTGCTGATGGGGTAAGG - Intronic
1037916629 8:22777133-22777155 ACTGATCTGCTCATGAGGGAGGG + Intronic
1038376246 8:27042933-27042955 TCTCATCTGTTGATGTTGCCTGG + Intergenic
1042447217 8:68899364-68899386 CATCATCTAGTGATGTGGGATGG + Intergenic
1043395003 8:79827497-79827519 TCTCATAGGAAGATGTGGGAGGG - Intergenic
1044042545 8:87387779-87387801 TATATTCTGCTGATTTGGGATGG - Intronic
1045095833 8:98797328-98797350 AGCCATCTGCTGATGGGGGAAGG - Intronic
1048680038 8:136831449-136831471 TCTTTTCTGCGGATGTGTGAAGG - Intergenic
1049606223 8:143530378-143530400 CGTCATCTGCTGGAGTGGGAGGG - Intronic
1051365325 9:16317606-16317628 TCCCATCAGCTCATCTGGGAAGG - Intergenic
1051596064 9:18825313-18825335 GATCATCTGCTGACCTGGGATGG - Intronic
1053098213 9:35347601-35347623 TCTCTTCTGGTGATATAGGAAGG - Intronic
1056046282 9:82720416-82720438 TCTCATCCGGTGATGTGGTTTGG - Intergenic
1057225682 9:93291951-93291973 TCCCATCGTCTGATGTGAGAGGG - Intronic
1059407977 9:114113659-114113681 TCTCATCTGGTGTTGGGGGAGGG - Intergenic
1059947038 9:119419937-119419959 TCTCATTTGCAGATGTGAAACGG + Intergenic
1060656592 9:125376427-125376449 TCTGATCTGCTGATGCCGGCTGG - Intergenic
1186224713 X:7386381-7386403 TTTCCTCTGCTGATGGGGGCAGG + Intergenic
1186786227 X:12958115-12958137 TCTTATATGCTGTTGTTGGAAGG - Intergenic
1187793297 X:22974482-22974504 TCTCATATGCTGGTGAGGGGAGG - Intergenic
1188017407 X:25120603-25120625 TCTATTCTGTTGATTTGGGATGG + Intergenic
1188037093 X:25330708-25330730 TCTATTCTGCTGATTTGGGGTGG - Intergenic
1188082676 X:25863354-25863376 TGTATTCTGCTGCTGTGGGATGG - Intergenic
1188088749 X:25936344-25936366 TCTATTCTGTTGATTTGGGATGG - Intergenic
1189234970 X:39479766-39479788 TCTCTTCTCCTCATCTGGGATGG - Intergenic
1190608881 X:52173438-52173460 TATAATCTGTTGATGTGGGGTGG - Intergenic
1191050555 X:56186549-56186571 TATAATCTGCTGATTTGGGGTGG - Intergenic
1192124047 X:68484823-68484845 TCTCTTCTGCTGTTGTTGGGTGG - Intergenic
1200853556 Y:7911467-7911489 TCTCATTTGCTGGTGGGGCAAGG - Intergenic