ID: 1133988305

View in Genome Browser
Species Human (GRCh38)
Location 16:10685005-10685027
Sequence CTGGCTAATGAGGCTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133988299_1133988305 7 Left 1133988299 16:10684975-10684997 CCAAGGGGGTGAGGACACACCAG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 155
1133988298_1133988305 8 Left 1133988298 16:10684974-10684996 CCCAAGGGGGTGAGGACACACCA 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 155
1133988297_1133988305 9 Left 1133988297 16:10684973-10684995 CCCCAAGGGGGTGAGGACACACC 0: 1
1: 0
2: 1
3: 14
4: 112
Right 1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133988305 Original CRISPR CTGGCTAATGAGGCTCTGGC TGG Intronic
900495377 1:2973742-2973764 CTGGCTTCTGAGGCTCTGGCAGG + Intergenic
900591383 1:3461788-3461810 CAGGCCATTGAGGCTCTGCCTGG + Intronic
902404218 1:16174243-16174265 CTGGCTAGTGAGGCTCTGGGTGG - Intergenic
906128276 1:43441063-43441085 CTGGCTAAGGAGCCTTGGGCAGG - Intronic
910516469 1:88066849-88066871 CTGGCTATTGATGAACTGGCTGG - Intergenic
912471616 1:109910840-109910862 CTGGCCAGTGAGGCTCGGCCCGG + Exonic
913119561 1:115727346-115727368 CTAGCAAATGAGGGTCGGGCAGG + Intronic
913233384 1:116760664-116760686 CTGCCTACTGAGGGCCTGGCAGG - Intronic
916202317 1:162283808-162283830 CAGGCTGGTGGGGCTCTGGCTGG + Intronic
919884758 1:201925098-201925120 CCAGCTCATGAGGCTCAGGCAGG + Intronic
920268428 1:204744375-204744397 CTGGCCAATGAGATTCAGGCAGG - Intergenic
923999621 1:239535929-239535951 ATGGCTAATGAGGCTGAGGCAGG + Intronic
1063265179 10:4440538-4440560 CTGGTTAAGGTGGGTCTGGCTGG + Intergenic
1063386896 10:5621394-5621416 CTGGCTGAGGAAGTTCTGGCTGG - Intergenic
1063975194 10:11409353-11409375 CTGGGCCATGAGGCTCTGGCAGG - Intergenic
1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG + Intergenic
1065971781 10:30811416-30811438 CTGGCTGCTGAGGGTCTGGAAGG - Intergenic
1066065186 10:31756599-31756621 CTGGATAATTAGGGTCTGCCGGG - Intergenic
1067664912 10:48269572-48269594 CTGGCTGATGGGACTCAGGCAGG + Intronic
1067686763 10:48470461-48470483 CAGGCTCCTGGGGCTCTGGCAGG + Intronic
1069704078 10:70446569-70446591 TTGTCTAGTGAGTCTCTGGCAGG + Intronic
1070018418 10:72558904-72558926 CTGGCTAATAGGGCTGAGGCAGG + Intronic
1070933274 10:80275402-80275424 CTTGCTAATGAAGCTTTGGCAGG - Intronic
1071493726 10:86153842-86153864 CTGGCCCAAGAGGTTCTGGCAGG - Intronic
1072922938 10:99591894-99591916 CTGGGGAATGAGGCTCTGGGAGG + Intergenic
1074556622 10:114497281-114497303 CTGGCCACTCAGGCTCAGGCAGG - Intronic
1076412756 10:130263774-130263796 GTGGCTTACGAGGCTATGGCCGG - Intergenic
1076868110 10:133179266-133179288 CTGGCCAGTGAGGCCCTGTCTGG + Intronic
1078608003 11:12794630-12794652 CTGGCCCAGGAGGCTCTGACAGG - Intronic
1079415805 11:20235432-20235454 CTGGTTAGTGAGGCTATTGCAGG - Intergenic
1080612438 11:33916129-33916151 CTGGCTCAGGAAGCTCTGGAAGG + Intergenic
1081666725 11:44921013-44921035 CTGGGTCCTGGGGCTCTGGCGGG + Intronic
1083826853 11:65208830-65208852 CTGGCCCAGGAGGCTCTGGGAGG - Intronic
1083966209 11:66045437-66045459 CTGGATAGTGAGGCCCTGGCTGG - Exonic
1084567880 11:69942010-69942032 CTGCCTACCGAGGCCCTGGCTGG + Intergenic
1090423104 11:126589147-126589169 CTGCCTCCTGCGGCTCTGGCTGG + Intronic
1092159392 12:6307786-6307808 TGGGCTAATGAGGGGCTGGCAGG - Intergenic
1092578758 12:9817345-9817367 CTGGCTTATGCAGCACTGGCAGG - Intergenic
1098684675 12:73403566-73403588 CTAGCTAAGGTGGCTATGGCAGG + Intergenic
1100897966 12:99205748-99205770 CTGGCTGATGAGTTACTGGCAGG + Intronic
1102158504 12:110749301-110749323 CTGGCTAATGTTGGCCTGGCTGG + Intergenic
1103891252 12:124240670-124240692 CTGGCTAATGATCCATTGGCTGG - Intronic
1103910813 12:124351089-124351111 CTGGCTAATAAGGGGCAGGCGGG + Intronic
1104847808 12:131855519-131855541 GGGGCTTAGGAGGCTCTGGCGGG + Intergenic
1105446042 13:20457942-20457964 CTGGCTTTCGAGGCTCTGCCGGG - Intronic
1110826079 13:79973919-79973941 CTGGATGAAGAGGCTCTGCCTGG - Intergenic
1112964525 13:105171195-105171217 CTGGCTGCTAAGGCACTGGCTGG + Intergenic
1113670089 13:112170566-112170588 TTGGATGCTGAGGCTCTGGCAGG - Intergenic
1114590628 14:23861365-23861387 CTGGGGAAAGAGGCTCTGACTGG - Intergenic
1114614630 14:24061812-24061834 CTTGCTATTTAGGGTCTGGCTGG + Intronic
1115509823 14:34128636-34128658 TTGGCCACTGAGGCTCAGGCAGG + Intronic
1119020565 14:71108654-71108676 CTGGCTACTGAGGCCCGGGCAGG - Exonic
1119449611 14:74697752-74697774 CTGACTAATGAGGCTGTCCCTGG - Intronic
1119755885 14:77119261-77119283 CTGGCTGAGGAGGCTGAGGCAGG - Intronic
1121448461 14:93993080-93993102 CTGGCAAAGGTGGCTCTGGTGGG - Intergenic
1122695460 14:103550111-103550133 CTGGCTGGGGAGGCTCTGGGCGG - Intergenic
1122819492 14:104334296-104334318 CTGTCTAAGGAGGCCCTGACAGG - Intergenic
1127007514 15:54586811-54586833 CTGGCTAACCAGGAGCTGGCTGG - Intronic
1127827652 15:62719071-62719093 CTGGTTAATGAGGCTCTCAGAGG - Intronic
1128739193 15:70072028-70072050 CTGCCTTGTGAGGCTCTGTCAGG + Intronic
1129188817 15:73926220-73926242 CTGGTAAGTGGGGCTCTGGCAGG - Intronic
1133844328 16:9440020-9440042 CTTGCTAAAGAGGCTCTGGAAGG + Intergenic
1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG + Intronic
1136067853 16:27770803-27770825 GTGGGAACTGAGGCTCTGGCTGG + Intronic
1136551106 16:30983070-30983092 CTGGCGGCTGAGGCTCTGGAAGG + Intronic
1137652664 16:50133885-50133907 CTGGCTGATGAGGGGGTGGCTGG + Intergenic
1138552899 16:57757023-57757045 CTGGCCCATGAGCCTCTGCCTGG + Exonic
1139371320 16:66471160-66471182 CTGGCTAATCAGGGTGTGTCTGG - Intronic
1140074951 16:71689708-71689730 CTTGCTAATGTTGCTCAGGCTGG + Intronic
1140460306 16:75134410-75134432 CTGGCTATTGATGCCCAGGCTGG - Intergenic
1142139299 16:88465618-88465640 CTGGCCAATGGGACTCTGCCTGG - Intronic
1203141984 16_KI270728v1_random:1772673-1772695 CTGGCTTATGGGGCTCCGGGGGG - Intergenic
1142552705 17:750908-750930 CTGGCTCAGGAGGCTCTCCCAGG + Intronic
1144950835 17:18992594-18992616 CTTGCTCAGGGGGCTCTGGCTGG - Intronic
1145728905 17:27157743-27157765 CAGGAAAATGAGGCTCTGGGAGG + Intergenic
1146510957 17:33448219-33448241 TTGGCTAATCAGGCTGTGGCTGG + Intronic
1146677570 17:34784030-34784052 CAGGGGAATGAGGATCTGGCAGG + Intergenic
1152033742 17:77859186-77859208 CAGGCAAAGGAGGCTCTGGTGGG - Intergenic
1152132368 17:78485058-78485080 CTGGCTCAGGAGGCGCAGGCGGG - Intronic
1155172905 18:23280346-23280368 CTGGGTACTGAGGCTGAGGCCGG + Intronic
1156383008 18:36581032-36581054 TTGCATAATGAGCCTCTGGCAGG - Intronic
1163398419 19:17077157-17077179 CTGGCTCTTGTGGCCCTGGCAGG + Intronic
1164524716 19:29004968-29004990 CTGGCTGATGGGGCGGTGGCAGG - Intergenic
1166596128 19:44051875-44051897 CTGGGTATTTTGGCTCTGGCAGG + Intronic
1168373003 19:55851775-55851797 CTGGATATTGAGGCTATGTCAGG + Intronic
925978098 2:9155225-9155247 CTGGCTCATGAGGGGCAGGCAGG - Intergenic
926735376 2:16069802-16069824 CCGGCCAATGAGGCACAGGCTGG + Intergenic
927453895 2:23232799-23232821 CTGGCTGAGGAGGGTCTGGTGGG - Intergenic
927513267 2:23657837-23657859 CGGGCTCCTGAGGCTCTGGCAGG + Intronic
929824465 2:45299480-45299502 CTGGTTATTTAGGTTCTGGCTGG - Intergenic
930775116 2:55163321-55163343 CTGACGAATGAGGATATGGCTGG - Intergenic
930846946 2:55916693-55916715 CTACCTAATCAGCCTCTGGCAGG + Intronic
933716579 2:85365836-85365858 CTGGTAGATGAGGCTCTGACAGG + Intronic
935096647 2:99951357-99951379 CTGGCAAATGAGCATTTGGCAGG - Intronic
936502244 2:113075277-113075299 CTGGCTGCTGGGGCTCTGCCGGG - Exonic
938065027 2:128277220-128277242 CTGGCAAATGAGGTTCTTTCAGG + Intronic
941883158 2:170502071-170502093 TTGGCTAAGGATGCTCTGACTGG + Intronic
944065477 2:195615356-195615378 CTGGCTATTGCTGCTCAGGCTGG + Intronic
946230210 2:218286664-218286686 CTGCCTACTGAGGCCCCGGCTGG + Exonic
1169786938 20:9369325-9369347 CTAGCTAGTAAGACTCTGGCAGG - Intronic
1172823826 20:37762906-37762928 ATGGATAATGGGCCTCTGGCTGG - Intronic
1173818385 20:46004998-46005020 CAGGCCAGAGAGGCTCTGGCAGG - Intergenic
1173828602 20:46063466-46063488 CAGGTTGATGAGGCTCTGGATGG + Exonic
1174550275 20:51357060-51357082 CTGGCTGCTCAGGCTCTGGGAGG - Intergenic
1178910306 21:36668679-36668701 CTGGCAAAGGGGACTCTGGCAGG + Intergenic
1181937343 22:26448413-26448435 CTGGCTTGTGTGGCTGTGGCAGG - Intronic
1183896137 22:40970477-40970499 CTGTATAATGAAGCACTGGCAGG - Intronic
1184287364 22:43479094-43479116 CTGTCTGTTGAGGTTCTGGCTGG + Intronic
1184659622 22:45959919-45959941 CTGGCTCCTGTGGCTCTGGGGGG - Intronic
952707971 3:36399290-36399312 CTGGCTAAAGAGGCACAGACAGG - Intronic
952713091 3:36451919-36451941 TTAGCTAATGAGTCTCTTGCAGG + Intronic
955067877 3:55548018-55548040 ATGCCTGATGAGGATCTGGCTGG + Intronic
955971657 3:64443870-64443892 CTGGCTGCTGGGGCTCTGGTTGG - Intronic
960373876 3:116874633-116874655 TTGGCTAATGAGGGGCTGGAGGG + Intronic
961188653 3:124938657-124938679 CTGGCTAGAGAGGCTCTTGATGG - Intronic
964424264 3:156534717-156534739 CTGGCTAATGTTGCTGGGGCTGG - Intronic
968222417 3:196948563-196948585 CTGGCTGCTCAGGCTCTGGGAGG - Exonic
968239484 3:197064032-197064054 CTGGCTAAGGAGGCTGAGGCAGG - Intronic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
979606554 4:122644742-122644764 CTGGCCAATGATTTTCTGGCTGG - Intergenic
985670954 5:1206505-1206527 CTGGCTAAGGAGACAGTGGCTGG + Intronic
986227530 5:5829419-5829441 GTGGCTGAAGAGGCTCTGGATGG + Intergenic
986273144 5:6251648-6251670 CAGGCTATTGATGCTCTGGCTGG + Intergenic
986658790 5:10040828-10040850 CTTGCAAGTAAGGCTCTGGCTGG - Intergenic
991920148 5:71648446-71648468 CTTGCTATTGAGTCACTGGCAGG + Intronic
992823438 5:80522071-80522093 CTGACTAATGCTGCTCTGACAGG - Exonic
993693882 5:91036836-91036858 CTGGCTTAAGAGTTTCTGGCAGG + Intronic
993695395 5:91055531-91055553 AAGGCTAATGAGGCTCAGACAGG + Intronic
997822380 5:137077736-137077758 CTGTCTTCTGAGGCCCTGGCTGG - Intronic
998386533 5:141760353-141760375 CTGGCCAATGAGGCGCTCACCGG - Intergenic
999333813 5:150697896-150697918 CTGGCTATAGTGGCTCTGGGAGG + Intronic
999458323 5:151736614-151736636 CTGGGGAATGTGGCTCTGGATGG - Intergenic
1000028354 5:157379812-157379834 CTGGATAAATAGGCTCTGTCTGG - Intronic
1003588831 6:7419479-7419501 CTGGGTCATAAGGCTGTGGCTGG + Intergenic
1004883948 6:20034295-20034317 CTGGAAAATGAGGCTCTGACAGG - Intergenic
1004927860 6:20432764-20432786 CTGTCTGATGAGGCTCTTCCAGG + Intronic
1005311570 6:24564158-24564180 CTGGCCATGCAGGCTCTGGCTGG - Intronic
1006911278 6:37565252-37565274 CTGGCTACTGTGCCTCTGTCTGG - Intergenic
1008232687 6:49003549-49003571 CTGGCAAATGATGCTATGGCAGG - Intergenic
1010794822 6:80106720-80106742 CTGGCTACTCAGGCTCAGGGCGG + Exonic
1011273680 6:85605899-85605921 TTTGCTAATGAGGGTCTGGTTGG - Intronic
1016048999 6:139510294-139510316 CCAGTTAATGGGGCTCTGGCTGG - Intergenic
1016158585 6:140846142-140846164 CTGGCTAATGTTGGTCAGGCTGG - Intergenic
1019660817 7:2223127-2223149 CTGTCTAATTACGCTCTGTCCGG + Intronic
1022028215 7:26468103-26468125 CTGGCTGCTGAGGCCCGGGCAGG + Intergenic
1024362063 7:48478583-48478605 CTGGCAAATCAGGTTATGGCGGG + Intronic
1025086150 7:56025098-56025120 CTGGGTACTGTGGCTCTGGTAGG - Intronic
1028556363 7:92129959-92129981 ATGGCTTATGAGGCTCTGTATGG - Intronic
1032125939 7:129192907-129192929 CTGACTACTGAGGCTTTGGAAGG + Intronic
1034359583 7:150482349-150482371 CTGGGTAATGAGGTTCTCACGGG + Intergenic
1034379197 7:150675104-150675126 CTGGGTAATGAGGTTCTCACGGG + Intergenic
1034523834 7:151641704-151641726 CTGGCTAATGTTGCCCAGGCTGG + Intronic
1035953743 8:4052929-4052951 GTGGCTAATGAGGGTCTGAGAGG + Intronic
1040761616 8:50852350-50852372 CTGGGCAGTGTGGCTCTGGCAGG + Intergenic
1041028980 8:53717014-53717036 CTGGGTATGGAGGCCCTGGCTGG + Intronic
1041329126 8:56704615-56704637 CTGGCTAATTAGGCTTTGAGGGG + Intergenic
1045549012 8:103153613-103153635 CTGGCACATCAGTCTCTGGCTGG - Intronic
1049778414 8:144416653-144416675 CTGGATCAAGAGGCTCTGGGCGG - Exonic
1052802306 9:32980395-32980417 TTGTCCAATGTGGCTCTGGCAGG + Intronic
1057579589 9:96274347-96274369 CTGGCTCAGGAGGCTGAGGCAGG + Intronic
1059531742 9:115041711-115041733 CTGCCTAAAGACACTCTGGCAGG - Intronic
1060828568 9:126700101-126700123 TAGGCAGATGAGGCTCTGGCTGG - Exonic
1061388249 9:130303045-130303067 CTGGCTGCTGAGGCCCTGGAGGG + Intronic
1061584753 9:131558473-131558495 CTGGGAAATGGGGCTCTGGTGGG - Intergenic
1187487954 X:19722345-19722367 GAGGGTAATGAGGCTGTGGCAGG - Intronic
1189052799 X:37664119-37664141 CTGGGAAATGAGGCACTTGCTGG + Intronic
1189528920 X:41857990-41858012 ATGGTTAATGATGGTCTGGCTGG - Intronic
1194798372 X:98240564-98240586 CTGGCTACAGAGGCTTTGCCTGG + Intergenic
1195965007 X:110422061-110422083 CTGGAAAATGGGGCTCTGGCTGG + Intronic
1197705302 X:129630442-129630464 CTGGTAAATGAGGGTCTGGAAGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198787013 X:140299722-140299744 CTCTCCAAGGAGGCTCTGGCAGG - Intergenic
1199205238 X:145140843-145140865 CTTGCTAAGGAGGCTGTGACAGG + Intergenic