ID: 1133993409

View in Genome Browser
Species Human (GRCh38)
Location 16:10728244-10728266
Sequence GCTGCTTGAGCTCCACGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133993399_1133993409 27 Left 1133993399 16:10728194-10728216 CCATTTTCCTGCCATCTCTGCCT No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993403_1133993409 7 Left 1133993403 16:10728214-10728236 CCTGGAACCTGCCCAGATTGTTT No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993401_1133993409 20 Left 1133993401 16:10728201-10728223 CCTGCCATCTCTGCCTGGAACCT No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993402_1133993409 16 Left 1133993402 16:10728205-10728227 CCATCTCTGCCTGGAACCTGCCC No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993406_1133993409 -5 Left 1133993406 16:10728226-10728248 CCAGATTGTTTTGAGACAGCTGC No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993405_1133993409 -4 Left 1133993405 16:10728225-10728247 CCCAGATTGTTTTGAGACAGCTG No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data
1133993404_1133993409 0 Left 1133993404 16:10728221-10728243 CCTGCCCAGATTGTTTTGAGACA No data
Right 1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133993409 Original CRISPR GCTGCTTGAGCTCCACGGGC TGG Intergenic
No off target data available for this crispr