ID: 1133997088

View in Genome Browser
Species Human (GRCh38)
Location 16:10756673-10756695
Sequence CACGTACTGCAGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133997088_1133997094 -9 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997094 16:10756687-10756709 CAGTACGTGGAAGACAACCTGGG 0: 1
1: 0
2: 0
3: 7
4: 130
1133997088_1133997098 6 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997098 16:10756702-10756724 AACCTGGGGGTGATGTCAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 109
1133997088_1133997096 -7 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997096 16:10756689-10756711 GTACGTGGAAGACAACCTGGGGG 0: 1
1: 0
2: 0
3: 4
4: 81
1133997088_1133997095 -8 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997095 16:10756688-10756710 AGTACGTGGAAGACAACCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 121
1133997088_1133997093 -10 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997093 16:10756686-10756708 GCAGTACGTGGAAGACAACCTGG 0: 1
1: 0
2: 2
3: 7
4: 66
1133997088_1133997097 5 Left 1133997088 16:10756673-10756695 CCCTGTTCCCTCTGCAGTACGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1133997097 16:10756701-10756723 CAACCTGGGGGTGATGTCAGTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133997088 Original CRISPR CACGTACTGCAGAGGGAACA GGG (reversed) Exonic
902614804 1:17618077-17618099 CCCAAAATGCAGAGGGAACATGG - Intronic
904156726 1:28489871-28489893 CAAGTAGTGCTGAGAGAACAGGG - Intronic
905387478 1:37614463-37614485 CAGGTACTGCAGAGGAATCTTGG + Intronic
908953291 1:69588943-69588965 CACCAACTGCATAGGGAAGAAGG - Intronic
911693383 1:100860808-100860830 AAGGTACTGGAGAAGGAACAAGG - Intergenic
913996708 1:143656646-143656668 CACATGCTTCTGAGGGAACAGGG + Intergenic
914319273 1:146544039-146544061 CACGGACTGCAGCGGGAAGAGGG - Intergenic
914505546 1:148286155-148286177 CACATGCTTCTGAGGGAACAGGG - Intergenic
914507016 1:148297996-148298018 CACATGCTTCTGAGGGAACAGGG + Intergenic
915035733 1:152922465-152922487 CACCTCCTGCAGAGGGAAGATGG - Intergenic
915586251 1:156845458-156845480 TACGCGCTGCAGAGGGCACAGGG - Intronic
915977213 1:160399527-160399549 CACTTACTCCAAGGGGAACATGG + Intergenic
919781455 1:201223978-201224000 CACGGAAAGCAGAGAGAACAAGG - Intronic
920414205 1:205787626-205787648 GCCGTCCTGCAGAGGGAACCAGG - Intergenic
922698418 1:227743509-227743531 CACGCAATGCAGAGGCAGCAAGG - Intronic
924271028 1:242332924-242332946 CAGGTACCTCACAGGGAACAAGG + Intronic
1063238948 10:4148914-4148936 CACGCCCTGCAAAGGGCACAAGG - Intergenic
1066477829 10:35765057-35765079 CAAGGACGGCAGAGGGAGCAGGG - Intergenic
1066714254 10:38269392-38269414 CAGGTACTGCATAGTGGACAAGG + Intergenic
1071412514 10:85410864-85410886 CACATGCTTCTGAGGGAACACGG - Intergenic
1075419350 10:122289143-122289165 CACCTGCTGCAGGGTGAACATGG - Intronic
1077813203 11:5659313-5659335 CATGCCCTGCAAAGGGAACAAGG + Intergenic
1080154506 11:29093036-29093058 CACTTAATGAAGAGGTAACAAGG + Intergenic
1083638120 11:64131165-64131187 CAGGCACTGCAGAGGGAAATGGG + Intronic
1086022187 11:82243886-82243908 CACCTACTGCAAAGAGAATATGG + Intergenic
1087681285 11:101220591-101220613 CACATGCTTCTGAGGGAACAGGG + Intergenic
1088428396 11:109730073-109730095 CAAGTACTGCGAAGGGATCAGGG + Intergenic
1088836867 11:113584909-113584931 AACGTAATGTAGTGGGAACAGGG - Intergenic
1092157673 12:6294988-6295010 CTAGTTATGCAGAGGGAACAGGG + Intergenic
1094605914 12:31949008-31949030 CACATGCTTCTGAGGGAACAGGG - Intergenic
1096746305 12:53729691-53729713 CATGTACTCCAGATGGAAAATGG + Intergenic
1098741140 12:74175038-74175060 CACATGCTTCTGAGGGAACAAGG + Intergenic
1100224617 12:92543531-92543553 CAAGTAATCCAGAGGGAATAAGG - Intergenic
1101566595 12:105911655-105911677 CACTTACTGCAGCTGGAAGATGG - Intergenic
1102428815 12:112865563-112865585 CAGGTGCTGCACAGGGAAGAAGG - Intronic
1102571691 12:113830697-113830719 GACTCACTGCAGAGGGAAAAGGG + Intronic
1105365885 13:19764154-19764176 CAAGTATTGCAGAAGAAACAAGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1109686415 13:65826855-65826877 CACCTGCTGCAGAGGGCACATGG + Intergenic
1112327125 13:98449370-98449392 GTCGGACTGCACAGGGAACACGG + Exonic
1113148869 13:107239889-107239911 CACCTGCTGGAGAGGGACCATGG + Intronic
1113714701 13:112494673-112494695 CACACACTGCGGAGGGAACATGG - Intronic
1113858430 13:113463874-113463896 CATGGACTGCCGTGGGAACATGG - Intronic
1113945370 13:114041021-114041043 CACGTGCTGCAGCTGGAACCAGG + Exonic
1114924837 14:27383779-27383801 CACGCCCTGCGAAGGGAACAAGG - Intergenic
1119767973 14:77202485-77202507 TAGGTCCTGCAGAGGGAGCACGG - Intronic
1120743570 14:88133644-88133666 AATGTCCTGCAGAGGGATCAAGG - Intergenic
1120924848 14:89787749-89787771 CCAGGACTGCAGAGAGAACAGGG + Intergenic
1122135464 14:99630305-99630327 CAGGGACTGCAGATGGACCAGGG - Intergenic
1122359362 14:101150469-101150491 CACAAACTCCAGAGGGAGCAGGG + Intergenic
1124141795 15:27083761-27083783 CACATACTGCAGATGGTACCTGG - Intronic
1128234886 15:66060509-66060531 CAGGTACTGCAGAGAGGAGAAGG - Intronic
1128748398 15:70131213-70131235 CAAGGACTGCAGAAGGATCAGGG - Intergenic
1133221157 16:4319729-4319751 CAGGGACTGGAGAGGGATCATGG + Intronic
1133997088 16:10756673-10756695 CACGTACTGCAGAGGGAACAGGG - Exonic
1134602266 16:15542755-15542777 CAAGTCCTGCAAAGGGGACAGGG - Intronic
1138249477 16:55490983-55491005 CGCATCCTTCAGAGGGAACATGG - Intronic
1138895980 16:61205408-61205430 CAGGGACTTCAGAGGGATCATGG - Intergenic
1140014251 16:71166045-71166067 CACGGACTGCAGCGGGAAGAGGG + Intronic
1142156118 16:88533526-88533548 CACGTACTGCGGAAGGAACAGGG - Exonic
1143453478 17:7050882-7050904 CACGACCTGCAGAGGGGATAAGG + Intergenic
1144057910 17:11558401-11558423 CACTTCCTACAGAGGGGACAAGG - Exonic
1145813586 17:27780195-27780217 CATGTCATGCAAAGGGAACAGGG + Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1151710121 17:75799710-75799732 CACATAGTGCAGTAGGAACATGG + Intronic
1152840834 17:82567059-82567081 GAAGCACTGCAGAGGGTACAAGG + Intronic
1152874731 17:82780126-82780148 CGCGAACTGCAAAGGCAACATGG - Intronic
1152898550 17:82927294-82927316 CACGGACAGCAGAGGGGACGTGG + Exonic
1157756265 18:50220435-50220457 CACATGCTTCTGAGGGAACAGGG + Intergenic
1159181323 18:64909408-64909430 CATGTACTGCAGAATAAACATGG - Intergenic
1160042866 18:75361154-75361176 CAGGTGGTGCAGAGGGAACGTGG + Intergenic
1162680160 19:12334497-12334519 CACACTCTGCAGAGGGCACAGGG - Intergenic
925910358 2:8569759-8569781 CATGCACTGCAGAGGGGACACGG - Intergenic
926133560 2:10320515-10320537 CACATACTGCACAGGAAGCATGG - Intronic
932173343 2:69577396-69577418 CACGTACTTAAGAGGGGGCAGGG + Intronic
937005122 2:118504619-118504641 CACTTACTGCTGTGGGAACTTGG + Intergenic
937232749 2:120408520-120408542 CACTTACAGCATAGTGAACATGG + Intergenic
938289453 2:130141715-130141737 CACCTTCTGCAGAGTGAACTGGG - Intronic
939736012 2:145846366-145846388 AACATACTGCAAATGGAACAAGG + Intergenic
1170807132 20:19641954-19641976 GACTTACTGCAGAGTGCACATGG - Intronic
1171767540 20:29298222-29298244 CACGTGCTGCACGGGGAACACGG + Intergenic
1173298012 20:41776574-41776596 CTCGTAATGCACAGGCAACAGGG + Intergenic
1173431187 20:42988338-42988360 CACGGACTGCATAGTCAACATGG - Intronic
1174103635 20:48146669-48146691 CACCTCCTGGAGAGGGACCACGG + Intergenic
1174170719 20:48616640-48616662 CCCGTGCTGCAGTGGGAGCAGGG - Intergenic
1175628746 20:60513187-60513209 CATTGACTGCAAAGGGAACAGGG - Intergenic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1181137213 22:20776630-20776652 CTGGTACTCCAGAGCGAACAAGG + Intronic
1183145057 22:35982569-35982591 CAAGAACTGCAGAATGAACAGGG + Intronic
1183625753 22:39000361-39000383 AATGTTCTGCAGAGAGAACATGG - Intergenic
1185127004 22:49016912-49016934 CACGTCCTGCGAAGGGGACAAGG - Intergenic
950807551 3:15620005-15620027 CACATGCTTCTGAGGGAACAGGG + Intronic
954692515 3:52403188-52403210 CACGGACAGCAGAGAGAAGACGG - Exonic
956868029 3:73388369-73388391 AATGCTCTGCAGAGGGAACATGG + Intronic
957064649 3:75511597-75511619 CACATGCTTCTGAGGGAACAGGG - Intergenic
959540680 3:107534322-107534344 CATGGACTGCAGAGGGAATGTGG + Intronic
960547292 3:118930273-118930295 CACCTACAGAAGAAGGAACAGGG + Exonic
963405057 3:144853304-144853326 CACATACTGTACAGGAAACATGG - Intergenic
963453188 3:145510744-145510766 CACGTACTGCAGAGGAATACTGG + Intergenic
968683744 4:1941332-1941354 CAGGTACAGTAGAGAGAACATGG + Intronic
969087171 4:4665169-4665191 CAAGAGCTTCAGAGGGAACATGG - Intergenic
969231515 4:5835092-5835114 CACATACTGCAGAAGGAGTATGG - Intronic
969885724 4:10213598-10213620 CACATGCTTCTGAGGGAACAAGG + Intergenic
970327078 4:14936932-14936954 CAGGTACAGCTGAGGGAAGAGGG + Intergenic
976913346 4:90337180-90337202 AATGTAATGCAGTGGGAACAGGG + Intronic
977441266 4:97070713-97070735 CACGTCCTGCAAAGTGATCAAGG + Intergenic
979320331 4:119315795-119315817 CACGTGTTGGAGAGGTAACAGGG + Intergenic
981230659 4:142351153-142351175 TTCATTCTGCAGAGGGAACATGG - Intronic
983205057 4:164902886-164902908 TACCTCCTGCAGTGGGAACAGGG + Intergenic
992093674 5:73340757-73340779 CACGCCCTGCAAGGGGAACAAGG + Intergenic
998352541 5:141511016-141511038 CACGTGCTGCAGGGTGAACTGGG - Exonic
998534303 5:142915287-142915309 CACGCCATGCAGAGGGAACCAGG - Intronic
998917094 5:147026123-147026145 TACCTACTCCAGAGGGAAAAAGG + Intronic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
1000742573 5:164987593-164987615 CAAGTCCTGCAAAGGGATCAAGG + Intergenic
1002198821 5:177515518-177515540 CACGTACAGCTGAGGCAACAAGG + Intronic
1002579146 5:180197116-180197138 ATCGTGCTGCAGAGGGACCAAGG - Intronic
1002914715 6:1519591-1519613 CAAGTACTGCAGAGAGGACTGGG + Intergenic
1009386751 6:63093719-63093741 CACATACTGCATAGGTAACGAGG - Intergenic
1015426894 6:133081509-133081531 AACATATTGCAGAGGGCACAGGG - Intergenic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1022184971 7:27958508-27958530 TGTGTGCTGCAGAGGGAACATGG + Intronic
1024301026 7:47887824-47887846 CACGGACTGTAGAGGCAAGAGGG + Intronic
1024953687 7:54893271-54893293 GAGGTACTGCAGAGGGAAAGAGG - Intergenic
1026517808 7:71087839-71087861 CTTGTTCTGCAGAGGCAACAGGG + Intergenic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1032066505 7:128775419-128775441 CAGGTACTGCAGGGGAAAAAGGG - Exonic
1032463572 7:132129357-132129379 CGGATTCTGCAGAGGGAACAGGG + Exonic
1033532963 7:142284603-142284625 AAAGTATTTCAGAGGGAACAGGG + Intergenic
1033791452 7:144796509-144796531 CAGGAACTGCACAGGGCACAGGG + Intronic
1036127066 8:6072644-6072666 AACCTCCTACAGAGGGAACAAGG + Intergenic
1036411602 8:8506725-8506747 CACGTCCTGCAAGGGGAATAAGG + Intergenic
1037490581 8:19393634-19393656 CAAGTACTGGGGAGGGGACAGGG + Intronic
1041538842 8:58959719-58959741 GACGTTCTGGAGAGGAAACAAGG + Intronic
1046174621 8:110559665-110559687 CACGTCCTGCAAAGGAAATAAGG - Intergenic
1046263558 8:111802132-111802154 CACGTACTGCTGAGGAAAATGGG + Intergenic
1049243508 8:141550361-141550383 CACATGCAGCAGAGGGAGCAGGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052926052 9:34017239-34017261 CATGTACTTCAGAGAAAACAAGG + Intronic
1056440600 9:86617247-86617269 CATGTAGTGCAGAGAGAGCAGGG - Intergenic
1057381189 9:94568963-94568985 CAGGCACTGCAGAGGAACCATGG - Intronic
1058780275 9:108325946-108325968 CACCTAAAGCAGAGGGTACAGGG - Intergenic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1061119953 9:128636211-128636233 CCCGCCCTGCAGAGGGCACAAGG - Intronic
1185682242 X:1898213-1898235 CATGTCCTGCAGAGGAATCAGGG + Intergenic
1186265585 X:7830203-7830225 TATGTACTGCAGAAGGAACAGGG + Intergenic
1187332291 X:18352012-18352034 CACCAACAGCAAAGGGAACAGGG + Intronic
1188183690 X:27088285-27088307 CACGTACTGCAAAGGGGATCAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1193358375 X:80550815-80550837 CACACCCTGCAGAGGGGACAAGG - Intergenic
1200117162 X:153774445-153774467 CTCGTACTGCACAGGGCCCAGGG - Exonic