ID: 1133997741

View in Genome Browser
Species Human (GRCh38)
Location 16:10761165-10761187
Sequence CTGTAGGGATGTAGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 418}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133997730_1133997741 8 Left 1133997730 16:10761134-10761156 CCAATCACCTCCCACCAGGAACT 0: 1
1: 17
2: 373
3: 2667
4: 5442
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997725_1133997741 18 Left 1133997725 16:10761124-10761146 CCCCCATGATCCAATCACCTCCC 0: 1777
1: 4271
2: 8923
3: 11671
4: 11382
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997727_1133997741 16 Left 1133997727 16:10761126-10761148 CCCATGATCCAATCACCTCCCAC 0: 1894
1: 4468
2: 9014
3: 11526
4: 10061
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997726_1133997741 17 Left 1133997726 16:10761125-10761147 CCCCATGATCCAATCACCTCCCA 0: 1985
1: 4581
2: 9603
3: 13047
4: 12705
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997732_1133997741 -2 Left 1133997732 16:10761144-10761166 CCCACCAGGAACTGCCTGTTCCT 0: 1
1: 0
2: 4
3: 23
4: 214
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997734_1133997741 -6 Left 1133997734 16:10761148-10761170 CCAGGAACTGCCTGTTCCTGTAG 0: 1
1: 0
2: 2
3: 15
4: 166
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997731_1133997741 1 Left 1133997731 16:10761141-10761163 CCTCCCACCAGGAACTGCCTGTT 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997733_1133997741 -3 Left 1133997733 16:10761145-10761167 CCACCAGGAACTGCCTGTTCCTG 0: 1
1: 0
2: 4
3: 34
4: 335
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418
1133997728_1133997741 15 Left 1133997728 16:10761127-10761149 CCATGATCCAATCACCTCCCACC 0: 1936
1: 4532
2: 7496
3: 10022
4: 10633
Right 1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG 0: 1
1: 0
2: 1
3: 54
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133997741 Original CRISPR CTGTAGGGATGTAGGGATGA TGG Intronic
900993132 1:6106984-6107006 GTGGAAGGATGGAGGGATGATGG + Intronic
900993146 1:6107036-6107058 ATGGAGGGATGGAGGAATGATGG + Intronic
900993191 1:6107192-6107214 ATGGAGGGATGGAGGGATGATGG + Intronic
900993197 1:6107211-6107233 ATGGAGGGATGGAGGGATGATGG + Intronic
900993209 1:6107260-6107282 ATGGAGAGATGGAGGGATGATGG + Intronic
900993232 1:6107366-6107388 ATGGAGAGATGGAGGGATGATGG + Intronic
900993245 1:6107409-6107431 ATGGAGGGATGGAGGGATGATGG + Intronic
900993250 1:6107428-6107450 ATGGAGGAATGAAGGGATGAGGG + Intronic
900993291 1:6107615-6107637 ATATAGGGATGAAGCGATGATGG + Intronic
900993296 1:6107634-6107656 ATGGAGGGATGAAGGGATGATGG + Intronic
900993307 1:6107683-6107705 ATATAGGGATGGAGGGATGATGG + Intronic
900993311 1:6107702-6107724 ATGGAGAGATGGAGGGATGATGG + Intronic
900993321 1:6107746-6107768 ATGGAGAGATGGAGGGATGATGG + Intronic
900993327 1:6107765-6107787 ATGGAGGGATGGAGGGATGATGG + Intronic
900993346 1:6107851-6107873 ATGGAGGGATGGAGGGATGATGG + Intronic
900993378 1:6107963-6107985 ATGGAAGGATGGAGGGATGATGG + Intronic
900993404 1:6108039-6108061 GTGAAGGGATGGAGGGATGGAGG + Intronic
900993407 1:6108047-6108069 ATGGAGGGATGGAGGGATGGAGG + Intronic
900993409 1:6108055-6108077 ATGGAGGGATGGAGGGATGATGG + Intronic
900993413 1:6108074-6108096 ATGGAGAGATGGAGGGATGATGG + Intronic
900993427 1:6108131-6108153 ATGGAGGGATGGAGGAATGATGG + Intronic
900993446 1:6108193-6108215 GTGGAGAGATGGAGGGATGATGG + Intronic
900993456 1:6108236-6108258 ATGGAGGGATGGAGAGATGACGG + Intronic
900993470 1:6108315-6108337 ACGGAGGGATGAAGGGATGAAGG + Intronic
900993535 1:6108591-6108613 GTGGAAGGATGGAGGGATGAAGG + Intronic
900993567 1:6108715-6108737 ATGAAGGGAAGGAGGGATGATGG + Intronic
900993622 1:6108914-6108936 ATGGAGGGATGGAGGGATGAAGG + Intronic
901699871 1:11039580-11039602 CTGGAAGGATGGATGGATGATGG + Intronic
901973053 1:12923160-12923182 CTGTTGGGGGGTAGGGATGGTGG + Intronic
902012128 1:13278603-13278625 CTGTTGGGGGGTAGGGATGGTGG - Intergenic
902071330 1:13741359-13741381 CTGCAAGGATGAAGGGGTGATGG - Intronic
903359943 1:22770744-22770766 CTGCAGGAAGGAAGGGATGAAGG + Intronic
903670257 1:25031201-25031223 CTGGAGGGATGGAGGGATGGAGG + Intergenic
903670309 1:25031393-25031415 CTGGAGGGATGAAAGGATGGAGG + Intergenic
904212901 1:28897543-28897565 CTGTAGGTAGGTAGGTAGGAAGG + Intronic
904232029 1:29082585-29082607 GGGTAGGGGTGGAGGGATGAAGG - Intronic
904604948 1:31693000-31693022 CTGCCGGGATGATGGGATGATGG + Intronic
904960951 1:34332421-34332443 CTGTAAGGATGCAGGGGTGAAGG - Intergenic
905220335 1:36441796-36441818 CTTCAGGGATGTTAGGATGAAGG - Intronic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
906772687 1:48499335-48499357 CTGTTGGGATGTTGGTGTGAGGG - Intergenic
907603613 1:55794210-55794232 CAGCAAGGATGTAGGGAGGAAGG - Intergenic
907620596 1:55974305-55974327 CTCTGGGGATGTAAAGATGAAGG - Intergenic
908286150 1:62605836-62605858 CTTTAGGGATTTAGGGATTTAGG - Exonic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909032178 1:70555261-70555283 CAGTAGGGATGTGGGGCAGAGGG - Intergenic
911772768 1:101768104-101768126 GGATAGGGAAGTAGGGATGAAGG - Intergenic
912390378 1:109298405-109298427 CTGCTGGGATTTGGGGATGAGGG + Intronic
912937506 1:114016531-114016553 CCTTAGGGAAGTAGGGATGTGGG - Intergenic
915289750 1:154875457-154875479 ATGTATGGATGTATGGATGATGG + Intergenic
915347660 1:155206126-155206148 CACTTGGGAAGTAGGGATGAGGG + Intronic
915516767 1:156417905-156417927 CAGGAGGGATGTGGGGGTGAGGG - Intronic
916415962 1:164592120-164592142 CTGGAGGGAGGTGGGGAGGAGGG + Intronic
916819705 1:168386539-168386561 CTGTAGTGATTTAGGGATCAAGG + Intergenic
919935156 1:202246162-202246184 GTGGAGGGATGGAGGGATGGGGG - Intronic
919935202 1:202246283-202246305 GTGGAGGGATGGAGGGATGGGGG - Intronic
920538495 1:206758626-206758648 CTGTAGGGATGTAGAGCGGTAGG - Intergenic
920538498 1:206758642-206758664 CTGTAAGGATGTAGAGCTGTAGG - Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
922745707 1:228042385-228042407 CTGGATGGATGGATGGATGATGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
1062827583 10:584058-584080 CTGAAGGGATGCAGGGATTTGGG - Intronic
1063265612 10:4446646-4446668 CTGTTGGGAGGTGGGGATTAAGG + Intergenic
1064601341 10:16996885-16996907 CTTTAGGAATGAAGGGATAAGGG - Intronic
1064868847 10:19914112-19914134 AGGTAGGGAGGTAGGGAGGAAGG + Intronic
1065777181 10:29131881-29131903 ATGTTGGGATGGTGGGATGAAGG + Intergenic
1068220474 10:54038681-54038703 TTGGAGTGATGTAGGGATGAAGG - Intronic
1069229934 10:65996467-65996489 TTCTAGGGATGTAGGAATGCAGG + Intronic
1069586491 10:69607434-69607456 CTCCAGGGATGTAGAGATGCAGG - Intergenic
1070630455 10:78081034-78081056 CTGGAGCGATGGTGGGATGAGGG + Intergenic
1071826222 10:89328902-89328924 CTATAGGGAGGTAGTGATGGTGG + Intronic
1071856104 10:89626047-89626069 CTGTAGGCATGAAGGGGAGAAGG - Intronic
1072019942 10:91388536-91388558 ATGTAGGCATTTAGTGATGAAGG + Intergenic
1073011251 10:100361492-100361514 ATGTATGAATGTAAGGATGAGGG + Exonic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073075940 10:100825980-100826002 CTGCAGGGAGGTGGGGAAGAGGG + Intronic
1075713223 10:124541852-124541874 CAGTGGGGAAGTAGGGGTGAAGG - Intronic
1076086627 10:127637617-127637639 CTCCAGGGATGTAGAGATGCAGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076844939 10:133065429-133065451 ATGTATGGATGGATGGATGATGG + Intergenic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077283139 11:1754427-1754449 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077283161 11:1754504-1754526 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077283171 11:1754529-1754551 ATGGAGGGATGGAGGGATGGAGG + Intronic
1077376070 11:2205588-2205610 CTGTTGGGAGGTAGGGAGGCTGG - Intergenic
1078430090 11:11281773-11281795 CTGAAGGGATGTGGGAAGGATGG + Intronic
1079453372 11:20616867-20616889 CTGTAGGACTGTAGGAATGATGG - Intronic
1079563876 11:21856581-21856603 ATGTAGGGATATAGGGATATTGG + Intergenic
1081552824 11:44129917-44129939 CGGAAGGGATGTGGGGCTGAAGG + Intronic
1081601831 11:44500656-44500678 ATGTGGGGAAGTAGTGATGATGG - Intergenic
1083459168 11:62799447-62799469 CTGTAGGATTGTGGGGGTGAGGG + Intronic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1083854152 11:65384112-65384134 CTGTAGGGAAGTGGGAATGAGGG - Intergenic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085810726 11:79678609-79678631 ATGGCGGGATGAAGGGATGAAGG - Intergenic
1087174305 11:95082067-95082089 CTGTTGTTATGTGGGGATGAGGG + Intergenic
1087757929 11:102074105-102074127 CTCTAGGGATGTGGAGATGCAGG + Intronic
1088374446 11:109124605-109124627 ATCTCGGGATGTAGGAATGAAGG + Intergenic
1088824576 11:113483019-113483041 ATGTATGGATGCAGGGAAGAGGG - Intergenic
1090856367 11:130612382-130612404 CTCTTGGGGTGGAGGGATGAGGG - Intergenic
1091036653 11:132240034-132240056 ATGGAGGGATGGACGGATGATGG - Intronic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091404620 12:201521-201543 AGGTAGGGATGTGGGGCTGAAGG + Intronic
1091410547 12:236502-236524 CTGGAGGGAGGAAGGGAAGAGGG - Intronic
1095046309 12:37511006-37511028 CTCTAGGTCTGAAGGGATGAAGG - Intergenic
1095910724 12:47424183-47424205 CTCCAGGGATGTAGAGATGCAGG - Intergenic
1096186862 12:49587247-49587269 GTGTAGGGAGGGAGAGATGAGGG - Intronic
1098754484 12:74342058-74342080 ATGAAGGGATATAGGGTTGATGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098918022 12:76277156-76277178 CTGTGGGGAGGTGGGGAGGAAGG - Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100551986 12:95654615-95654637 ATGATGGGATGTTGGGATGATGG + Intergenic
1100551988 12:95654623-95654645 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552000 12:95654679-95654701 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552002 12:95654687-95654709 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552004 12:95654695-95654717 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552006 12:95654703-95654725 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552014 12:95654743-95654765 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552016 12:95654751-95654773 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552018 12:95654759-95654781 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552020 12:95654767-95654789 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552024 12:95654783-95654805 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552029 12:95654807-95654829 ATGTTGGAATGTTGGGATGATGG + Intergenic
1100552031 12:95654815-95654837 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552041 12:95654855-95654877 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552048 12:95654887-95654909 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552050 12:95654895-95654917 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552054 12:95654911-95654933 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552063 12:95654943-95654965 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552067 12:95654959-95654981 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552075 12:95654991-95655013 ATGTTGGGATATTGGGATGATGG + Intergenic
1100552079 12:95655007-95655029 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552083 12:95655023-95655045 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552087 12:95655039-95655061 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552089 12:95655047-95655069 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552098 12:95655087-95655109 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552105 12:95655119-95655141 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552107 12:95655127-95655149 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552111 12:95655143-95655165 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552117 12:95655167-95655189 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552126 12:95655199-95655221 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552132 12:95655223-95655245 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552140 12:95655255-95655277 ATGTTGGGATATTGGGATGATGG + Intergenic
1100552144 12:95655271-95655293 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552148 12:95655287-95655309 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552154 12:95655311-95655333 ATGTTGGGATGTTGGGATGTTGG + Intergenic
1100552156 12:95655319-95655341 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552165 12:95655359-95655381 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552169 12:95655375-95655397 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552171 12:95655383-95655405 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552181 12:95655423-95655445 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100552190 12:95655455-95655477 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552192 12:95655463-95655485 ATGTTGGGATGATGGGATGATGG + Intergenic
1100552196 12:95655479-95655501 ATGATGGGATGTTGGGATGATGG + Intergenic
1100552202 12:95655503-95655525 ATGTTGGGATGTTGGGATGATGG + Intergenic
1100552207 12:95655527-95655549 ATGTTGGGATGATGGGATGATGG + Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1102176044 12:110875752-110875774 CGTTAGGGATGAAGGGAAGAGGG - Intronic
1102452729 12:113053843-113053865 GTGTATGGATGAATGGATGATGG + Intergenic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1103352380 12:120293696-120293718 CTGGAGGTAAGTAGTGATGATGG - Intergenic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1105214933 13:18278502-18278524 TTGTAGGGATGTGAGAATGAGGG + Intergenic
1106571944 13:30935073-30935095 CTGCAGGGATGGATGGGTGAAGG - Intronic
1109885188 13:68532684-68532706 ATATAGAGATGTAGAGATGAAGG - Intergenic
1113891112 13:113736030-113736052 CTGTTGGGCTGTTGGGAGGAGGG + Exonic
1114720121 14:24872719-24872741 CTATAAGGATCTAAGGATGATGG - Intronic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1117962761 14:61179153-61179175 CTCTGGGGATGAAGGGATGGGGG + Intergenic
1118223459 14:63877017-63877039 CTCTAAGGATGAAAGGATGAGGG + Intronic
1118323437 14:64766589-64766611 CTGCAGGGATGTGGGGAGGATGG + Intronic
1119264455 14:73255746-73255768 CTGTAGGGACCTTGAGATGAAGG + Intronic
1119294583 14:73522636-73522658 CTGGATGCATGCAGGGATGATGG + Exonic
1120862456 14:89267067-89267089 CTGTAGGGAAGAAGGGAAGAAGG - Intronic
1121054156 14:90839275-90839297 CTGGAGAGACCTAGGGATGAAGG + Intergenic
1121467830 14:94127510-94127532 CTGTTGGGAGGCAGGGGTGAGGG - Intergenic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1126288794 15:47047529-47047551 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1126822239 15:52515725-52515747 CTGTAGGGATCTAGGTTTGTAGG + Intronic
1127102906 15:55586147-55586169 CTTAAGTGATGTAGAGATGAAGG - Intronic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128675942 15:69608447-69608469 CTGGAGGGATGTAAAGAGGAAGG + Intergenic
1128793601 15:70449815-70449837 GTGGAGGGATGGAGGGATGGAGG + Intergenic
1128793751 15:70450368-70450390 ATGGAGGGATGAAGGGATGGAGG + Intergenic
1130984271 15:88834454-88834476 CTGGATGGATTTGGGGATGAGGG - Intronic
1132356096 15:101172596-101172618 CTGCAGGGGTGTAGGGGTGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1135256911 16:20948416-20948438 CTGTAGCCATATAGAGATGACGG + Intronic
1136104924 16:28023583-28023605 TGGTAAGGATGTAGGGATGTGGG - Intronic
1136270619 16:29146292-29146314 CTGTGGGGATGTGGGGATTGAGG + Intergenic
1136270629 16:29146322-29146344 CTGTGGGGATGTGGGGATGGGGG + Intergenic
1136270639 16:29146352-29146374 CTGTGGGGATGTGGGGACGGGGG + Intergenic
1136270674 16:29146472-29146494 CTGTGGGGATGTGGGGATGGAGG + Intergenic
1137630784 16:49942706-49942728 CTGGAGGGATGTAGAGAAAAGGG + Intergenic
1137676774 16:50307573-50307595 CTGGTGGGGTATAGGGATGAGGG + Intronic
1139247250 16:65457135-65457157 ATAAAGGGATGTAGGGAAGAAGG - Intergenic
1139982737 16:70872795-70872817 CTGCATGGATGGATGGATGATGG - Intronic
1140697249 16:77547402-77547424 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1141483748 16:84325084-84325106 ATGGATGGATGGAGGGATGAAGG - Intronic
1141854871 16:86674018-86674040 GTGTATGGATGAAGGGATGGAGG - Intergenic
1142074207 16:88108103-88108125 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074217 16:88108133-88108155 CTGTGGGGATGTGGGGATGGGGG + Intronic
1142074226 16:88108163-88108185 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074253 16:88108253-88108275 CTGTGGGGATGTGGGGATGGAGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143669387 17:8385939-8385961 CTGTATGGATGGTGGGCTGAAGG - Intergenic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1145184984 17:20786286-20786308 ATGTATGAATGTAAGGATGAGGG + Intergenic
1145879883 17:28345241-28345263 CTGCAGGGAAGTGGGGATTAGGG - Exonic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1149869253 17:60168069-60168091 ATGTAGAGATGTAGAGATGTAGG + Intronic
1152006555 17:77685838-77685860 ATGGAGGGATGAAGGGATGGAGG - Intergenic
1152189273 17:78878713-78878735 CTGCAGGGAAGTGGGGGTGAGGG + Intronic
1153641942 18:7165103-7165125 CTGTAGGGTTGTGAGGAAGAGGG - Intergenic
1153655381 18:7277628-7277650 CTGCAGGGCTGTGGAGATGAGGG - Intergenic
1155795657 18:30033765-30033787 CTGTTGGGAGGTGGGGGTGAGGG - Intergenic
1156346517 18:36261759-36261781 AAGTAAGGATGGAGGGATGAGGG - Intronic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1157030751 18:43904721-43904743 CTGTAGTCAAGTAGAGATGAGGG + Intergenic
1158939541 18:62394206-62394228 CAGTAAGGAAGTTGGGATGACGG - Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159631428 18:70752872-70752894 CTGGAGGTATGTAGAGATAATGG - Intergenic
1161329178 19:3678282-3678304 GTGGAGGGATGGAGGGATGGAGG + Intronic
1161329302 19:3678704-3678726 CGGGAGGGATGGAGGGATGGCGG + Intronic
1162541105 19:11296487-11296509 CAGGAGGGATGTAGGGCAGACGG + Intronic
1163038106 19:14583299-14583321 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163038795 19:14587556-14587578 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163039541 19:14592223-14592245 CTTGAGGGATGGAGGGAGGAGGG + Intronic
1163238484 19:16043630-16043652 ATGAATGGATGAAGGGATGAAGG + Intergenic
1163383551 19:16985299-16985321 ATGTATGGATGGATGGATGAAGG + Intronic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1164743523 19:30594474-30594496 CTGGAGGGAGGTAGGGAGAAAGG - Intronic
1166316168 19:41991447-41991469 CTGTAGGGCAGTAGGAAAGATGG - Intronic
1166689671 19:44814818-44814840 CTTCAGGGCTGTAGGGAGGAGGG - Intronic
1167191935 19:47996554-47996576 ATGGATGGATGTATGGATGATGG + Intronic
927400281 2:22703379-22703401 ATGTAGGGATGTAGAGATATAGG - Intergenic
927400283 2:22703395-22703417 GTCTAGGGATGTAGGGATGTAGG - Intergenic
927769368 2:25845708-25845730 GTGAAGGGATGTGGGGATGGAGG - Intronic
929084769 2:38157621-38157643 CTGTAGGGATGTCTGGTGGAGGG - Intergenic
931088174 2:58857148-58857170 CAGGAGGGATGGAGAGATGAAGG + Intergenic
932126696 2:69151371-69151393 CTGTAGGGAGGCAGGGTGGAGGG + Intronic
932795855 2:74695509-74695531 GTTGAGGGTTGTAGGGATGAGGG - Intergenic
934299387 2:91768235-91768257 TTGTAGGGATGTGAGAATGAGGG - Intergenic
934920247 2:98337875-98337897 CTGGATGGATGGATGGATGATGG - Intronic
935132024 2:100267775-100267797 TTCTAGGGAGGCAGGGATGAGGG - Intergenic
935315971 2:101834197-101834219 ATGGAGGGATGGAGGGATGGAGG - Intronic
935315974 2:101834205-101834227 ATGGAGGGATGGAGGGATGGAGG - Intronic
935543868 2:104379873-104379895 TTGATGGGATGTAGGTATGATGG - Intergenic
935782293 2:106518909-106518931 GTGGAGGGATGGAGGGATGGAGG - Intergenic
937487438 2:122329998-122330020 CTGTAGGGATTTTGTAATGATGG + Intergenic
937522504 2:122729477-122729499 TTGGAGGGCTGTGGGGATGATGG - Intergenic
937659798 2:124417770-124417792 CTGTAGGAATGTAGTTGTGATGG + Intronic
937669665 2:124524912-124524934 CTCTAGGGATGTGGGGAAGGAGG - Intronic
938125020 2:128665126-128665148 CTGGAGGGAAGTAGGAATGAGGG - Intergenic
938636539 2:133233857-133233879 CTGTAGGTATGTGGGGAGAAGGG - Intronic
939759497 2:146156444-146156466 CTGTAGGAAAGTAGATATGATGG + Intergenic
939875027 2:147568223-147568245 ATGGAGGGATGGAGGGATGAAGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
941232598 2:162930119-162930141 CTCTAAGGATGTAGGCATAAAGG + Intergenic
942035364 2:172005302-172005324 CTCTAGGGATGCAGGGGTGAAGG - Intronic
942494737 2:176527905-176527927 CTGAAGGGATATAAGGTTGATGG - Intergenic
945341137 2:208656304-208656326 ATGGAGGGATGGAGGGATGGAGG - Intronic
946236548 2:218327752-218327774 CAGTAGAGATGTAGGGAGGAAGG - Intronic
946828596 2:223704907-223704929 CTGCTGGCATGTGGGGATGATGG - Intergenic
947073815 2:226319732-226319754 CTATAGCCATGAAGGGATGAAGG + Intergenic
947860723 2:233355190-233355212 CTTTTGGGATGAAGGGGTGAAGG - Intronic
947913444 2:233817467-233817489 CTGGATGGAGGTGGGGATGAAGG + Intronic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169708614 20:8536133-8536155 CTGAAGTCATGTAAGGATGAGGG + Intronic
1170240909 20:14165056-14165078 CTCCAGGGATGTGGGGATGCAGG + Intronic
1170243981 20:14200381-14200403 AGGTTGGGATGTTGGGATGAGGG + Intronic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1170841524 20:19928274-19928296 CTTTGGGGATTTAAGGATGAGGG + Intronic
1171540877 20:25954607-25954629 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171800191 20:29605703-29605725 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1171843904 20:30251000-30251022 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1172619026 20:36307400-36307422 ATGGAGGGATGAAGGGATGGAGG - Intronic
1172619029 20:36307408-36307430 ATGGAGGGATGGAGGGATGAAGG - Intronic
1172619031 20:36307416-36307438 ATGGAGGGATGGAGGGATGGAGG - Intronic
1172619034 20:36307424-36307446 CCGGAGGGATGGAGGGATGGAGG - Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173087703 20:39940081-39940103 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1173309211 20:41881786-41881808 ATGTAGGGATTCAGGGATGGAGG - Intergenic
1173309214 20:41881794-41881816 ATGGAGGGATGTAGGGATTCAGG - Intergenic
1175123656 20:56735882-56735904 CAGCAGGGATGAAGGGATGGTGG - Intergenic
1175984034 20:62755356-62755378 ATGGAGGGATGAAGGGAGGAAGG - Intronic
1175984113 20:62755592-62755614 ATGGAGGGAGGGAGGGATGATGG - Intronic
1175984211 20:62755868-62755890 ATGGAGGGAGGGAGGGATGATGG - Intronic
1176045902 20:63092453-63092475 CTGCAGGGACATTGGGATGATGG - Intergenic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1179072348 21:38083466-38083488 CTGTAGGGAGGTGGGGAGGAAGG - Intronic
1179492827 21:41752423-41752445 CTGCAGGGAGGTAGGGGGGAAGG + Intronic
1179864905 21:44210824-44210846 ATGGAGGGATGGAGGGATGGAGG + Intergenic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1181528523 22:23502970-23502992 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1182698620 22:32212730-32212752 CTCTAGGGATGTGGAGATGCAGG + Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183633313 22:39046295-39046317 CTGTGAGGAGGTGGGGATGAGGG + Intronic
1184293397 22:43509689-43509711 ATGGAGGGATGGAGGGATGAAGG - Intergenic
1184293411 22:43509734-43509756 ATGGAGGGATGGATGGATGAGGG - Intergenic
1184369371 22:44072842-44072864 TACTAGGGATGTAGGGATAAAGG + Intronic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
949692569 3:6656653-6656675 CTCTAGGGAAGTAGGTCTGAAGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
953759623 3:45676450-45676472 CTGTTGGGAGGTGGGGGTGAGGG - Intronic
954887386 3:53887757-53887779 CTGTAGGGATGCAAAGATGTGGG - Intronic
955142652 3:56285098-56285120 CTGGGGGGAGGTAGGGATGGGGG - Intronic
955175965 3:56613046-56613068 CTCTAGGGATGTGGAGATGCAGG + Intronic
956113313 3:65893179-65893201 CAGTAGAGAAGAAGGGATGAAGG - Intronic
957295744 3:78330597-78330619 CTGGGGGGAGGTAGGGATCATGG + Intergenic
959109210 3:102101649-102101671 CTGTCGGGAGGTAGGGGTAAGGG + Intronic
959190418 3:103103780-103103802 CTTAAGGGATATGGGGATGATGG + Intergenic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
960519939 3:118643101-118643123 CTGTAGGCATGGAGGTCTGAGGG - Intergenic
960926596 3:122800615-122800637 CTGTAGCCATGTAGGCAAGATGG + Intronic
963428310 3:145161532-145161554 ATTTATGGATGTAGAGATGAGGG + Intergenic
963575812 3:147059606-147059628 CTTTAAGCATGTAGGGATCAGGG - Intergenic
964653591 3:159041357-159041379 GTGAAAAGATGTAGGGATGAGGG + Intronic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
968492145 4:895733-895755 TTGGAGAGATGCAGGGATGAGGG + Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
970142333 4:12996168-12996190 CTGCAGGGATATAGGGGAGATGG - Intergenic
970438070 4:16054913-16054935 TTGCAGGGATTTAGTGATGAGGG - Intronic
972854274 4:43087488-43087510 AGCTAGTGATGTAGGGATGAAGG + Intergenic
975341858 4:73251317-73251339 CTGAAGGGATGTAGAGTTGTGGG - Intronic
976136678 4:81945107-81945129 CTGTGGGGAGGTGGGGATGGGGG + Intronic
979197322 4:117935978-117936000 CTGTTGGGATGTGGGGGTGAGGG - Intergenic
979524367 4:121701888-121701910 CTGCTGGGATGTAGAGATGATGG - Intergenic
979989374 4:127356410-127356432 ATGTAGGATTGCAGGGATGATGG - Intergenic
981206754 4:142050776-142050798 CTGTAGGTACCAAGGGATGATGG - Intronic
981842295 4:149126612-149126634 CAGAAGGGAGGGAGGGATGAAGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983109106 4:163726045-163726067 CTGTATATATGTAGGGATGGGGG - Intronic
984402766 4:179287972-179287994 GTGTTGGGATGTGGGGATGCTGG + Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985897415 5:2757011-2757033 CTGGAGGGACGGAGGGTTGAGGG - Intergenic
986890518 5:12299368-12299390 CTCTAGGGATGTGGAGATGCAGG - Intergenic
987901170 5:24013570-24013592 CTACAGGGATGTAGAGATGCAGG + Intronic
988407274 5:30839989-30840011 CAGGAGGGATGTGGGGAGGAGGG - Intergenic
988719778 5:33865296-33865318 CCCCAGGGATGTAGGGACGATGG + Intronic
989654986 5:43736990-43737012 CTTTAGGGATGAAGAGATGCGGG + Intergenic
990765546 5:59178200-59178222 GCATAGGGATGGAGGGATGAGGG - Intronic
990970246 5:61497994-61498016 CTGTGGGGGTCTAGGGATGAGGG + Intronic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994060565 5:95472257-95472279 CTATAGGGAGGAAGGAATGAAGG - Intronic
995401895 5:111751739-111751761 CTGGAGTGATGTAGGAGTGAAGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999461548 5:151761098-151761120 CTGTAGGCATGTATAGATGGTGG + Intronic
999923396 5:156347461-156347483 CTGGTTGGATGTAGGGTTGAGGG + Intronic
1000141551 5:158409288-158409310 CTGCATGGAGGTAGAGATGAAGG - Intergenic
1000372922 5:160554516-160554538 CTTTAGTGATGTAGGGAAGGAGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002302307 5:178264044-178264066 CGTTAGGGATGGGGGGATGAAGG + Intronic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003869183 6:10388351-10388373 CTATAGGGATGTGGAAATGAGGG + Intergenic
1004317792 6:14605712-14605734 CTGTAGGGATTTAGGTATGTAGG - Intergenic
1005592962 6:27348015-27348037 CTTTAGGGATGTGGAGATGCGGG - Intergenic
1006093035 6:31639423-31639445 CTGAAGGGATCCAGGGAAGAGGG + Intronic
1006336767 6:33425149-33425171 GTGTATGGAGGTAGGGATGGAGG + Intronic
1006401238 6:33818774-33818796 GTGTAGGTATGTATGGATGCAGG - Intergenic
1006795792 6:36731647-36731669 CTGGAGGGATCTGGGGAGGAAGG - Intronic
1007676154 6:43596771-43596793 CTGTAGGGAGGTAGAGCTAAGGG + Intronic
1008475005 6:51927217-51927239 CTAGAGGGATGTGGGGTTGAAGG - Intronic
1009839136 6:69044233-69044255 ATGTAAGGGTGGAGGGATGAAGG - Intronic
1012889329 6:104880887-104880909 CTGTAGGAATGTAGGTTTGGTGG - Intergenic
1015458097 6:133452540-133452562 GTGTATGGCAGTAGGGATGAAGG + Intronic
1015551351 6:134415355-134415377 CTCTACGGATGTAGAGTTGAAGG + Intergenic
1015715694 6:136189730-136189752 CTGGAGGGATGGTGGGGTGACGG - Intronic
1016773702 6:147880770-147880792 CTGTTGAGTTGTTGGGATGACGG - Intergenic
1017618569 6:156271559-156271581 CTGTAGGGATGGTGGTATCATGG - Intergenic
1018492962 6:164315591-164315613 CTGCTGGCATGTAGTGATGAAGG + Intergenic
1018886357 6:167941007-167941029 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886369 6:167941065-167941087 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886392 6:167941179-167941201 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886404 6:167941237-167941259 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886440 6:167941409-167941431 ACAGAGGGATGTAGGGATGAGGG + Intronic
1018886452 6:167941467-167941489 ACAGAGGGATGTAGGGATGAGGG + Intronic
1019103461 6:169650289-169650311 ATGGAGGGATGCAGAGATGAGGG - Intronic
1019103476 6:169650341-169650363 ATGGAGGGATGCAGAGATGAGGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019503248 7:1376146-1376168 CTGTAAGGAGGTGGGGATGCCGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1021128609 7:16883350-16883372 ATGGAGGGATGGAGGGATGGAGG - Intergenic
1022872851 7:34497565-34497587 CTGTTGGGAGGTGGGGGTGAGGG - Intergenic
1023003552 7:35838372-35838394 CTGTAGGGAGGGAGGGAGGGAGG - Intronic
1026275208 7:68870337-68870359 CTGGATGGATGGATGGATGATGG + Intergenic
1026978146 7:74511277-74511299 CTGTAGGGAGGGTGGGCTGAAGG + Intronic
1029750224 7:102538942-102538964 CTGTTGGGATTTGGGGAGGAGGG - Intronic
1029768175 7:102638050-102638072 CTGTTGGGATTTGGGGAGGAGGG - Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030406588 7:109122407-109122429 GTGTTGGGTTGTGGGGATGAAGG + Intergenic
1030575796 7:111284362-111284384 CTGTAGTAATGTAGTAATGAAGG - Intronic
1030687736 7:112504163-112504185 CTGCAGGGATGTGGAGATGCAGG + Intergenic
1031260209 7:119508069-119508091 CTGTAGCCATGTAGGCATTAGGG - Intergenic
1031575635 7:123412712-123412734 CTGTTCTGCTGTAGGGATGATGG - Intergenic
1032610631 7:133408484-133408506 CAGTAGGGTGGTAAGGATGATGG + Intronic
1032895310 7:136244090-136244112 CTGTTGGGAGGTTGGGAGGAAGG - Intergenic
1035049342 7:155989720-155989742 TTCTAGGAATGAAGGGATGATGG + Intergenic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037034008 8:14143779-14143801 CTGCAGAGATGTAGGGAGGGTGG - Intronic
1037709223 8:21342346-21342368 CTGGAGGGATGGAGGGGTGGAGG + Intergenic
1039560225 8:38506390-38506412 CTGTAGGGATGTGTCCATGAGGG + Intergenic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1045087788 8:98705690-98705712 CAATAAGGATGTAGGAATGAGGG - Intronic
1047506764 8:125486335-125486357 ATGTGGGGATGTCGGGATGTCGG - Intergenic
1047506766 8:125486343-125486365 CTCTCGGGATGTGGGGATGTCGG - Intergenic
1048348317 8:133595332-133595354 CTGATGGGAAGTAGGGCTGATGG - Intergenic
1049403955 8:142443346-142443368 CTGTAGGGGGGTTAGGATGAGGG + Intergenic
1049639817 8:143710423-143710445 CTGCAGGGATGCAGGGATGCAGG - Intronic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050143254 9:2538637-2538659 CTGTGGGGAGGTGGGGAGGAGGG - Intergenic
1050284815 9:4090251-4090273 CTGTTGGGCTGTAGGCAGGAAGG - Intronic
1050458749 9:5858815-5858837 CTGGAAGGATGGATGGATGATGG + Intergenic
1051120997 9:13752307-13752329 CCGTGGGGATGTATGGGTGAGGG + Intergenic
1051234086 9:14980220-14980242 CTGTATGGATGGATGAATGAAGG + Intergenic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1053061576 9:35036201-35036223 CCGTAGGGATGTAGTGTTAAGGG - Intergenic
1054164194 9:61704849-61704871 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1055031376 9:71773907-71773929 CTGTAGGGAAGTAGGCAGGATGG - Intronic
1055033105 9:71790471-71790493 TTGTATGGATGTAGGAATGTAGG + Intronic
1056466509 9:86860931-86860953 CAGTAGGGAGGTAGTGATCAAGG - Intergenic
1056548414 9:87632150-87632172 ATGTATGTATGTAGAGATGAAGG + Intronic
1056548452 9:87632482-87632504 CAGTATATATGTAGGGATGAAGG + Intronic
1056548467 9:87632622-87632644 CAGTATATATGTAGGGATGAAGG + Intronic
1056548522 9:87633185-87633207 CAGTATATATGTAGGGATGAAGG + Intronic
1057106238 9:92420272-92420294 ATGTTGGGAGGTATGGATGAGGG - Intronic
1058646505 9:107135960-107135982 CTGTAAGGATTTGGGGATTAGGG - Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1061036822 9:128118811-128118833 GTGCAGGGATGGAGGGATGGAGG + Intergenic
1061255643 9:129453319-129453341 ATGGAGGGATGGAGGGATGGGGG + Intergenic
1061613904 9:131766668-131766690 CTGCAGGGATGTGGGGGAGAGGG + Intergenic
1062086957 9:134653942-134653964 CTGGAGGTGTGTAGGGCTGAGGG + Intronic
1062087032 9:134654259-134654281 CTGTAGGTGTGTAGGGCTGGAGG + Intronic
1062201380 9:135304575-135304597 GTGGAGGGATGGAGGGCTGATGG + Intergenic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1186338992 X:8623013-8623035 CTGGATGGATGGATGGATGATGG + Intronic
1187326366 X:18294618-18294640 CTCTAGGGATGTGGAGATGTAGG - Intronic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1189888872 X:45577791-45577813 CTACAGGGATGTAGAGATGCAGG + Intergenic
1190740219 X:53283670-53283692 CTGAAGGGAGGAAGGAATGAAGG + Intronic
1191034179 X:56007243-56007265 CTTTTGGGATGTAGAGATGCAGG + Intergenic
1191152248 X:57232104-57232126 CTGTATAGATGGAGGGATGAAGG + Intergenic
1192264701 X:69530396-69530418 CTGTAGGGATATGGGCAGGAGGG - Exonic
1192635074 X:72808250-72808272 CTGTAGGGGGGGAGGGACGATGG - Intronic
1192646641 X:72912553-72912575 CTGTAGGGGGGGAGGGACGATGG + Intronic
1193226049 X:78985556-78985578 CTGTAGGGATGAAGTGCTCATGG - Intergenic
1193671888 X:84397264-84397286 CTCCAGGGATGTGGAGATGAAGG + Intronic
1193892295 X:87064887-87064909 CTGTAGGGATCAAGGGTGGAAGG + Intergenic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1195119559 X:101736617-101736639 CTGTAGGGATCCAGGAAAGATGG + Intergenic
1195842566 X:109190451-109190473 ATGTAGGGAAGTAGTGATAAGGG - Intergenic
1195968075 X:110447450-110447472 GTGTGGGGATGTAGGGGAGATGG + Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic